Incidental Mutation 'R1851:Map4k1'
ID208086
Institutional Source Beutler Lab
Gene Symbol Map4k1
Ensembl Gene ENSMUSG00000037337
Gene Namemitogen-activated protein kinase kinase kinase kinase 1
SynonymsHpk1
MMRRC Submission 039875-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1851 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28982050-29003279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28999784 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 521 (Y521H)
Ref Sequence ENSEMBL: ENSMUSP00000146807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000085835] [ENSMUST00000179893] [ENSMUST00000207185] [ENSMUST00000208227] [ENSMUST00000214374]
Predicted Effect probably benign
Transcript: ENSMUST00000032813
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085835
AA Change: Y567H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082995
Gene: ENSMUSG00000037337
AA Change: Y567H

DomainStartEndE-ValueType
S_TKc 17 274 3.58e-84 SMART
low complexity region 301 318 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 385 416 N/A INTRINSIC
low complexity region 426 446 N/A INTRINSIC
CNH 506 813 4.93e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179893
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207185
AA Change: Y567H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208227
AA Change: Y521H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208784
Predicted Effect probably benign
Transcript: ENSMUST00000214374
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have increased responses of B and T cells. Dendritic cells are also hyperresponsive to stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik A G 12: 18,533,686 E225G possibly damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Abi1 A T 2: 22,950,264 V329D possibly damaging Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acox3 A T 5: 35,609,062 D624V possibly damaging Het
Adam6b A G 12: 113,491,822 D753G probably benign Het
Ago1 C A 4: 126,439,995 R771L probably benign Het
Aktip A G 8: 91,125,877 V217A possibly damaging Het
Ankk1 A C 9: 49,415,850 H676Q probably benign Het
Arl1 G C 10: 88,733,546 probably benign Het
Asxl3 T A 18: 22,517,739 D928E probably damaging Het
AW209491 T C 13: 14,636,733 V57A possibly damaging Het
B3galt4 G T 17: 33,950,911 Q118K probably benign Het
Ccdc187 A T 2: 26,276,068 M783K probably benign Het
Cdon T G 9: 35,483,158 M900R probably damaging Het
Ceacam5 G A 7: 17,714,910 W67* probably null Het
Chd5 A G 4: 152,378,270 S1356G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cpz C A 5: 35,502,558 R581L possibly damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cym T A 3: 107,218,714 I78F probably benign Het
Defb8 A T 8: 19,445,883 S54T probably benign Het
Dennd4a A G 9: 64,862,030 T433A probably damaging Het
Dhx29 A G 13: 112,948,281 T678A probably damaging Het
Dspp T C 5: 104,174,085 probably null Het
Enkur G T 2: 21,189,177 A195E probably benign Het
Ero1lb T A 13: 12,604,403 S429T possibly damaging Het
Fh1 A G 1: 175,607,886 S344P probably damaging Het
Flnc G T 6: 29,443,479 G553V probably damaging Het
Fmo1 A T 1: 162,829,985 L529* probably null Het
Frem1 C A 4: 82,950,500 V1415F probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gdpgp1 A T 7: 80,238,601 N127Y probably damaging Het
Gm11492 T A 11: 87,568,915 D496E probably damaging Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gm13212 T G 4: 145,624,250 probably benign Het
Gpat2 A G 2: 127,434,819 T648A possibly damaging Het
Grk6 C T 13: 55,451,778 R225* probably null Het
Hells A T 19: 38,959,676 Q682L probably null Het
Hspa5 T A 2: 34,774,678 N381K possibly damaging Het
Ighmbp2 T C 19: 3,262,075 N893S probably benign Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lats2 A G 14: 57,697,455 L606P probably damaging Het
March11 T A 15: 26,387,830 V257E probably damaging Het
Med23 G A 10: 24,910,870 probably null Het
Meltf A G 16: 31,896,577 D696G probably benign Het
Ms4a7 T A 19: 11,324,424 M212L probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myh1 T C 11: 67,204,398 Y195H probably damaging Het
Napb G T 2: 148,706,989 H110Q probably benign Het
Ngly1 C T 14: 16,260,585 P90S probably damaging Het
Nlrp1b T A 11: 71,182,616 I134L possibly damaging Het
Nup210 A G 6: 91,016,054 L1017P probably damaging Het
Nup85 T A 11: 115,581,817 I233N probably damaging Het
Obsl1 A G 1: 75,492,893 V965A probably damaging Het
Olfr1259 A C 2: 89,943,814 Y100* probably null Het
Olfr1310 T C 2: 112,008,691 D165G probably benign Het
Olfr787 T C 10: 129,463,501 L275P probably damaging Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Pard6g C T 18: 80,117,142 R157C probably damaging Het
Pcdhb7 A T 18: 37,342,578 T256S possibly damaging Het
Phrf1 T C 7: 141,240,918 F153L probably damaging Het
Pigw A T 11: 84,878,048 F152I probably damaging Het
Pip4k2c A G 10: 127,200,875 S222P probably damaging Het
Pjvk A G 2: 76,657,431 probably null Het
Plxnd1 C T 6: 115,963,914 V1355M probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Scn7a T C 2: 66,680,291 I1256V probably benign Het
Sema4d A G 13: 51,711,222 V362A possibly damaging Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Tacc3 G T 5: 33,668,200 V425L probably benign Het
Tfdp2 A T 9: 96,297,709 K125I probably damaging Het
Tjp2 C T 19: 24,099,535 R952Q possibly damaging Het
Tk2 G T 8: 104,248,445 S30* probably null Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Tmprss9 G A 10: 80,892,285 V570M probably damaging Het
Tnk2 C A 16: 32,679,462 P26Q probably damaging Het
Tnpo2 T G 8: 85,051,772 V610G probably damaging Het
Trim37 T C 11: 87,218,306 F953S probably damaging Het
U2surp T A 9: 95,482,097 K589* probably null Het
Usp2 G A 9: 44,075,966 R187H probably benign Het
Vmn2r1 C T 3: 64,101,505 T535I probably benign Het
Wdr20rt T A 12: 65,227,151 S463T possibly damaging Het
Zbtb25 C A 12: 76,349,714 G245W probably damaging Het
Zc3h14 T A 12: 98,760,354 L27* probably null Het
Zfp2 T C 11: 50,901,088 K43E probably benign Het
Zfp654 A G 16: 64,785,128 Y904H probably benign Het
Other mutations in Map4k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Map4k1 APN 7 29001619 missense probably damaging 0.98
IGL01936:Map4k1 APN 7 28988607 missense possibly damaging 0.90
IGL02473:Map4k1 APN 7 28999872 missense probably damaging 1.00
IGL02934:Map4k1 APN 7 28994106 missense probably benign 0.00
IGL03180:Map4k1 APN 7 28988085 missense probably damaging 1.00
IGL03199:Map4k1 APN 7 28983417 missense probably damaging 1.00
IGL03493:Map4k1 APN 7 28984151 unclassified probably benign
R0333:Map4k1 UTSW 7 28999761 unclassified probably benign
R1296:Map4k1 UTSW 7 28998452 missense possibly damaging 0.96
R1305:Map4k1 UTSW 7 28995465 missense probably benign
R1519:Map4k1 UTSW 7 28991036 missense probably benign 0.00
R1711:Map4k1 UTSW 7 28989352 missense possibly damaging 0.80
R1842:Map4k1 UTSW 7 28987163 missense probably damaging 1.00
R2042:Map4k1 UTSW 7 28984130 missense probably damaging 1.00
R2274:Map4k1 UTSW 7 29001957 missense probably damaging 1.00
R2275:Map4k1 UTSW 7 29001957 missense probably damaging 1.00
R4426:Map4k1 UTSW 7 28988595 missense probably damaging 1.00
R4568:Map4k1 UTSW 7 28986654 missense probably damaging 1.00
R4858:Map4k1 UTSW 7 28988770 missense probably damaging 1.00
R4903:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R4964:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R4966:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R5124:Map4k1 UTSW 7 28988832 missense probably damaging 1.00
R5778:Map4k1 UTSW 7 28994221 missense probably benign 0.37
R5786:Map4k1 UTSW 7 29000020 missense probably damaging 1.00
R6343:Map4k1 UTSW 7 29000290 missense possibly damaging 0.76
R6475:Map4k1 UTSW 7 28987022 missense probably damaging 1.00
R6702:Map4k1 UTSW 7 29002396 missense possibly damaging 0.86
R6703:Map4k1 UTSW 7 29002396 missense possibly damaging 0.86
R6856:Map4k1 UTSW 7 28986834 missense probably damaging 1.00
R6870:Map4k1 UTSW 7 29001671 critical splice donor site probably null
R6904:Map4k1 UTSW 7 28986802 missense probably damaging 1.00
R7081:Map4k1 UTSW 7 28991149 missense probably benign
R7572:Map4k1 UTSW 7 28987138 missense probably benign 0.01
R7868:Map4k1 UTSW 7 28999962 critical splice acceptor site probably null
R8034:Map4k1 UTSW 7 28988148 missense probably damaging 1.00
R8054:Map4k1 UTSW 7 28989756 splice site probably benign
Z1177:Map4k1 UTSW 7 29000008 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTAAGCAGATCACGGTGATG -3'
(R):5'- TGTCCTGGATCTTACTGGAGACC -3'

Sequencing Primer
(F):5'- AGATCACGGTGATGCCTGGAC -3'
(R):5'- CTGGATCTTACTGGAGACCATGTTC -3'
Posted On2014-06-23