Incidental Mutation 'R1851:Tfdp2'
ID208100
Institutional Source Beutler Lab
Gene Symbol Tfdp2
Ensembl Gene ENSMUSG00000032411
Gene Nametranscription factor Dp 2
SynonymsA330080J22Rik, DP3, DP3, 1110029I05Rik, DP-3
MMRRC Submission 039875-MU
Accession Numbers

Genbank: NM_001184706.1, NM_001184708.1, NM_001184709.1, NM_001184710.1, NM_001184711.1, NM_178667.4

Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R1851 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location96196275-96323646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96297709 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 125 (K125I)
Ref Sequence ENSEMBL: ENSMUSP00000141084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034982] [ENSMUST00000165120] [ENSMUST00000165768] [ENSMUST00000179065] [ENSMUST00000179416] [ENSMUST00000185644] [ENSMUST00000186609] [ENSMUST00000188008] [ENSMUST00000188750] [ENSMUST00000188829] [ENSMUST00000189606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034982
AA Change: K140I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034982
Gene: ENSMUSG00000032411
AA Change: K140I

DomainStartEndE-ValueType
Pfam:E2F_TDP 66 147 3.8e-29 PFAM
DP 154 298 1.69e-87 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165120
AA Change: K65I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132934
Gene: ENSMUSG00000032411
AA Change: K65I

DomainStartEndE-ValueType
Pfam:E2F_TDP 1 72 3.2e-25 PFAM
DP 79 223 1.69e-87 SMART
low complexity region 270 286 N/A INTRINSIC
low complexity region 296 310 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165768
AA Change: K141I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128260
Gene: ENSMUSG00000032411
AA Change: K141I

DomainStartEndE-ValueType
E2F_TDP 66 148 1.39e-33 SMART
DP 155 299 1.69e-87 SMART
low complexity region 346 362 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179065
AA Change: K114I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136817
Gene: ENSMUSG00000032411
AA Change: K114I

DomainStartEndE-ValueType
Pfam:E2F_TDP 40 121 3.9e-29 PFAM
DP 128 272 1.69e-87 SMART
low complexity region 319 335 N/A INTRINSIC
low complexity region 345 359 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179416
AA Change: K140I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137176
Gene: ENSMUSG00000032411
AA Change: K140I

DomainStartEndE-ValueType
Pfam:E2F_TDP 66 147 3.8e-29 PFAM
DP 154 298 1.69e-87 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185644
AA Change: K140I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140061
Gene: ENSMUSG00000032411
AA Change: K140I

DomainStartEndE-ValueType
Pfam:E2F_TDP 66 147 3.8e-29 PFAM
DP 154 298 1.69e-87 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186609
AA Change: K89I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139891
Gene: ENSMUSG00000032411
AA Change: K89I

DomainStartEndE-ValueType
Pfam:E2F_TDP 14 96 3.2e-27 PFAM
DP 103 203 4e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188008
AA Change: K125I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139848
Gene: ENSMUSG00000032411
AA Change: K125I

DomainStartEndE-ValueType
Pfam:E2F_TDP 50 132 1e-26 PFAM
DP 139 283 8e-92 SMART
low complexity region 330 346 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188750
AA Change: K201I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139926
Gene: ENSMUSG00000032411
AA Change: K201I

DomainStartEndE-ValueType
Pfam:E2F_TDP 127 208 1.3e-26 PFAM
DP 215 359 8e-92 SMART
low complexity region 406 422 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188829
SMART Domains Protein: ENSMUSP00000140359
Gene: ENSMUSG00000032411

DomainStartEndE-ValueType
Pfam:E2F_TDP 66 108 4.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189606
AA Change: K125I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141084
Gene: ENSMUSG00000032411
AA Change: K125I

DomainStartEndE-ValueType
Pfam:E2F_TDP 50 132 1e-26 PFAM
DP 139 283 8e-92 SMART
low complexity region 330 346 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the transcription factor DP family. The encoded protein forms heterodimers with the E2F transcription factors resulting in transcriptional activation of cell cycle regulated genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI

 All alleles(416) : Targeted, other(1) Gene trapped(415)

SNPs within 2kb(416 from dbSNP Build 128)  

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik A G 12: 18,533,686 E225G possibly damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Abi1 A T 2: 22,950,264 V329D possibly damaging Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acox3 A T 5: 35,609,062 D624V possibly damaging Het
Adam6b A G 12: 113,491,822 D753G probably benign Het
Ago1 C A 4: 126,439,995 R771L probably benign Het
Aktip A G 8: 91,125,877 V217A possibly damaging Het
Ankk1 A C 9: 49,415,850 H676Q probably benign Het
Arl1 G C 10: 88,733,546 probably benign Het
Asxl3 T A 18: 22,517,739 D928E probably damaging Het
AW209491 T C 13: 14,636,733 V57A possibly damaging Het
B3galt4 G T 17: 33,950,911 Q118K probably benign Het
Ccdc187 A T 2: 26,276,068 M783K probably benign Het
Cdon T G 9: 35,483,158 M900R probably damaging Het
Ceacam5 G A 7: 17,714,910 W67* probably null Het
Chd5 A G 4: 152,378,270 S1356G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cpz C A 5: 35,502,558 R581L possibly damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cym T A 3: 107,218,714 I78F probably benign Het
Defb8 A T 8: 19,445,883 S54T probably benign Het
Dennd4a A G 9: 64,862,030 T433A probably damaging Het
Dhx29 A G 13: 112,948,281 T678A probably damaging Het
Dspp T C 5: 104,174,085 probably null Het
Enkur G T 2: 21,189,177 A195E probably benign Het
Ero1lb T A 13: 12,604,403 S429T possibly damaging Het
Fh1 A G 1: 175,607,886 S344P probably damaging Het
Flnc G T 6: 29,443,479 G553V probably damaging Het
Fmo1 A T 1: 162,829,985 L529* probably null Het
Frem1 C A 4: 82,950,500 V1415F probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gdpgp1 A T 7: 80,238,601 N127Y probably damaging Het
Gm11492 T A 11: 87,568,915 D496E probably damaging Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gm13212 T G 4: 145,624,250 probably benign Het
Gpat2 A G 2: 127,434,819 T648A possibly damaging Het
Grk6 C T 13: 55,451,778 R225* probably null Het
Hells A T 19: 38,959,676 Q682L probably null Het
Hspa5 T A 2: 34,774,678 N381K possibly damaging Het
Ighmbp2 T C 19: 3,262,075 N893S probably benign Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lats2 A G 14: 57,697,455 L606P probably damaging Het
Map4k1 T C 7: 28,999,784 Y521H probably benign Het
March11 T A 15: 26,387,830 V257E probably damaging Het
Med23 G A 10: 24,910,870 probably null Het
Meltf A G 16: 31,896,577 D696G probably benign Het
Ms4a7 T A 19: 11,324,424 M212L probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myh1 T C 11: 67,204,398 Y195H probably damaging Het
Napb G T 2: 148,706,989 H110Q probably benign Het
Ngly1 C T 14: 16,260,585 P90S probably damaging Het
Nlrp1b T A 11: 71,182,616 I134L possibly damaging Het
Nup210 A G 6: 91,016,054 L1017P probably damaging Het
Nup85 T A 11: 115,581,817 I233N probably damaging Het
Obsl1 A G 1: 75,492,893 V965A probably damaging Het
Olfr1259 A C 2: 89,943,814 Y100* probably null Het
Olfr1310 T C 2: 112,008,691 D165G probably benign Het
Olfr787 T C 10: 129,463,501 L275P probably damaging Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Pard6g C T 18: 80,117,142 R157C probably damaging Het
Pcdhb7 A T 18: 37,342,578 T256S possibly damaging Het
Phrf1 T C 7: 141,240,918 F153L probably damaging Het
Pigw A T 11: 84,878,048 F152I probably damaging Het
Pip4k2c A G 10: 127,200,875 S222P probably damaging Het
Pjvk A G 2: 76,657,431 probably null Het
Plxnd1 C T 6: 115,963,914 V1355M probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Scn7a T C 2: 66,680,291 I1256V probably benign Het
Sema4d A G 13: 51,711,222 V362A possibly damaging Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Tacc3 G T 5: 33,668,200 V425L probably benign Het
Tjp2 C T 19: 24,099,535 R952Q possibly damaging Het
Tk2 G T 8: 104,248,445 S30* probably null Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Tmprss9 G A 10: 80,892,285 V570M probably damaging Het
Tnk2 C A 16: 32,679,462 P26Q probably damaging Het
Tnpo2 T G 8: 85,051,772 V610G probably damaging Het
Trim37 T C 11: 87,218,306 F953S probably damaging Het
U2surp T A 9: 95,482,097 K589* probably null Het
Usp2 G A 9: 44,075,966 R187H probably benign Het
Vmn2r1 C T 3: 64,101,505 T535I probably benign Het
Wdr20rt T A 12: 65,227,151 S463T possibly damaging Het
Zbtb25 C A 12: 76,349,714 G245W probably damaging Het
Zc3h14 T A 12: 98,760,354 L27* probably null Het
Zfp2 T C 11: 50,901,088 K43E probably benign Het
Zfp654 A G 16: 64,785,128 Y904H probably benign Het
Other mutations in Tfdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:Tfdp2 APN 9 96295030 missense probably damaging 1.00
IGL01737:Tfdp2 APN 9 96300412 missense possibly damaging 0.79
IGL02725:Tfdp2 APN 9 96287695 missense possibly damaging 0.50
IGL02754:Tfdp2 APN 9 96317539 missense probably benign 0.08
IGL02975:Tfdp2 APN 9 96317936 unclassified probably benign
I2289:Tfdp2 UTSW 9 96317795 nonsense probably null
R0329:Tfdp2 UTSW 9 96306893 missense probably damaging 1.00
R0330:Tfdp2 UTSW 9 96306893 missense probably damaging 1.00
R0478:Tfdp2 UTSW 9 96290583 missense probably benign 0.01
R1843:Tfdp2 UTSW 9 96317804 missense possibly damaging 0.90
R2121:Tfdp2 UTSW 9 96295014 missense probably damaging 1.00
R2432:Tfdp2 UTSW 9 96310590 missense probably damaging 1.00
R4635:Tfdp2 UTSW 9 96297674 missense probably damaging 1.00
R5970:Tfdp2 UTSW 9 96317574 missense unknown
R7488:Tfdp2 UTSW 9 96297642 missense probably damaging 1.00
R7905:Tfdp2 UTSW 9 96310606 missense
R8222:Tfdp2 UTSW 9 96310613 missense possibly damaging 0.59
Z1177:Tfdp2 UTSW 9 96306858 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGATGCTTTCACTGGGCATAG -3'
(R):5'- CCTCCAGTTCAAAATATTCCAGAG -3'

Sequencing Primer
(F):5'- ACAGCATGTGAAAGATAACC -3'
(R):5'- GTCTTGCATGCAAAACCC -3'
Posted On2014-06-23