Incidental Mutation 'R1851:Nup85'
ID208117
Institutional Source Beutler Lab
Gene Symbol Nup85
Ensembl Gene ENSMUSG00000020739
Gene Namenucleoporin 85
Synonymsfrount, Pcnt1
MMRRC Submission 039875-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1851 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115564434-115583985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115581817 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 233 (I233N)
Ref Sequence ENSEMBL: ENSMUSP00000117333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000021085] [ENSMUST00000106508] [ENSMUST00000140986] [ENSMUST00000144473] [ENSMUST00000156173]
Predicted Effect probably benign
Transcript: ENSMUST00000019135
SMART Domains Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 222 299 1.7e-20 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Alpha_adaptinC2 586 710 6.09e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000021085
AA Change: I491N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021085
Gene: ENSMUSG00000020739
AA Change: I491N

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 53 606 1.2e-181 PFAM
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106508
SMART Domains Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 1.3e-32 PFAM
low complexity region 377 393 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
low complexity region 454 476 N/A INTRINSIC
Alpha_adaptinC2 508 632 6.09e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138998
Predicted Effect probably damaging
Transcript: ENSMUST00000140986
AA Change: I233N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117333
Gene: ENSMUSG00000020739
AA Change: I233N

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 21 280 5.9e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143351
Predicted Effect probably damaging
Transcript: ENSMUST00000144473
AA Change: I266N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116069
Gene: ENSMUSG00000020739
AA Change: I266N

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 1 170 3e-56 PFAM
Pfam:Nucleopor_Nup85 168 274 1.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154832
Predicted Effect probably benign
Transcript: ENSMUST00000156173
SMART Domains Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 7.3e-32 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the Nup107-160 subunit of the nuclear pore complex. Nuclear pore complexes are embedded in the nuclear envelope and promote bidirectional transport of macromolecules between the cytoplasm and nucleus. The encoded protein can also bind to the C-terminus of chemokine (C-C motif) receptor 2 (CCR2) and promote chemotaxis of monocytes, thereby participating in the inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik A G 12: 18,533,686 E225G possibly damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Abi1 A T 2: 22,950,264 V329D possibly damaging Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acox3 A T 5: 35,609,062 D624V possibly damaging Het
Adam6b A G 12: 113,491,822 D753G probably benign Het
Ago1 C A 4: 126,439,995 R771L probably benign Het
Aktip A G 8: 91,125,877 V217A possibly damaging Het
Ankk1 A C 9: 49,415,850 H676Q probably benign Het
Arl1 G C 10: 88,733,546 probably benign Het
Asxl3 T A 18: 22,517,739 D928E probably damaging Het
AW209491 T C 13: 14,636,733 V57A possibly damaging Het
B3galt4 G T 17: 33,950,911 Q118K probably benign Het
Ccdc187 A T 2: 26,276,068 M783K probably benign Het
Cdon T G 9: 35,483,158 M900R probably damaging Het
Ceacam5 G A 7: 17,714,910 W67* probably null Het
Chd5 A G 4: 152,378,270 S1356G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cpz C A 5: 35,502,558 R581L possibly damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cym T A 3: 107,218,714 I78F probably benign Het
Defb8 A T 8: 19,445,883 S54T probably benign Het
Dennd4a A G 9: 64,862,030 T433A probably damaging Het
Dhx29 A G 13: 112,948,281 T678A probably damaging Het
Dspp T C 5: 104,174,085 probably null Het
Enkur G T 2: 21,189,177 A195E probably benign Het
Ero1lb T A 13: 12,604,403 S429T possibly damaging Het
Fh1 A G 1: 175,607,886 S344P probably damaging Het
Flnc G T 6: 29,443,479 G553V probably damaging Het
Fmo1 A T 1: 162,829,985 L529* probably null Het
Frem1 C A 4: 82,950,500 V1415F probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gdpgp1 A T 7: 80,238,601 N127Y probably damaging Het
Gm11492 T A 11: 87,568,915 D496E probably damaging Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gm13212 T G 4: 145,624,250 probably benign Het
Gpat2 A G 2: 127,434,819 T648A possibly damaging Het
Grk6 C T 13: 55,451,778 R225* probably null Het
Hells A T 19: 38,959,676 Q682L probably null Het
Hspa5 T A 2: 34,774,678 N381K possibly damaging Het
Ighmbp2 T C 19: 3,262,075 N893S probably benign Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lats2 A G 14: 57,697,455 L606P probably damaging Het
Map4k1 T C 7: 28,999,784 Y521H probably benign Het
March11 T A 15: 26,387,830 V257E probably damaging Het
Med23 G A 10: 24,910,870 probably null Het
Meltf A G 16: 31,896,577 D696G probably benign Het
Ms4a7 T A 19: 11,324,424 M212L probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myh1 T C 11: 67,204,398 Y195H probably damaging Het
Napb G T 2: 148,706,989 H110Q probably benign Het
Ngly1 C T 14: 16,260,585 P90S probably damaging Het
Nlrp1b T A 11: 71,182,616 I134L possibly damaging Het
Nup210 A G 6: 91,016,054 L1017P probably damaging Het
Obsl1 A G 1: 75,492,893 V965A probably damaging Het
Olfr1259 A C 2: 89,943,814 Y100* probably null Het
Olfr1310 T C 2: 112,008,691 D165G probably benign Het
Olfr787 T C 10: 129,463,501 L275P probably damaging Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Pard6g C T 18: 80,117,142 R157C probably damaging Het
Pcdhb7 A T 18: 37,342,578 T256S possibly damaging Het
Phrf1 T C 7: 141,240,918 F153L probably damaging Het
Pigw A T 11: 84,878,048 F152I probably damaging Het
Pip4k2c A G 10: 127,200,875 S222P probably damaging Het
Pjvk A G 2: 76,657,431 probably null Het
Plxnd1 C T 6: 115,963,914 V1355M probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Scn7a T C 2: 66,680,291 I1256V probably benign Het
Sema4d A G 13: 51,711,222 V362A possibly damaging Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Tacc3 G T 5: 33,668,200 V425L probably benign Het
Tfdp2 A T 9: 96,297,709 K125I probably damaging Het
Tjp2 C T 19: 24,099,535 R952Q possibly damaging Het
Tk2 G T 8: 104,248,445 S30* probably null Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Tmprss9 G A 10: 80,892,285 V570M probably damaging Het
Tnk2 C A 16: 32,679,462 P26Q probably damaging Het
Tnpo2 T G 8: 85,051,772 V610G probably damaging Het
Trim37 T C 11: 87,218,306 F953S probably damaging Het
U2surp T A 9: 95,482,097 K589* probably null Het
Usp2 G A 9: 44,075,966 R187H probably benign Het
Vmn2r1 C T 3: 64,101,505 T535I probably benign Het
Wdr20rt T A 12: 65,227,151 S463T possibly damaging Het
Zbtb25 C A 12: 76,349,714 G245W probably damaging Het
Zc3h14 T A 12: 98,760,354 L27* probably null Het
Zfp2 T C 11: 50,901,088 K43E probably benign Het
Zfp654 A G 16: 64,785,128 Y904H probably benign Het
Other mutations in Nup85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Nup85 APN 11 115581756 missense probably damaging 1.00
IGL01538:Nup85 APN 11 115569714 missense possibly damaging 0.81
IGL01775:Nup85 APN 11 115580767 missense probably damaging 1.00
IGL02170:Nup85 APN 11 115577931 missense probably damaging 0.97
IGL02456:Nup85 APN 11 115581865 unclassified probably benign
IGL02888:Nup85 APN 11 115578800 missense possibly damaging 0.89
IGL03210:Nup85 APN 11 115566636 missense probably benign 0.11
PIT4403001:Nup85 UTSW 11 115581820 missense probably damaging 0.98
R0195:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0394:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0639:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0883:Nup85 UTSW 11 115568370 nonsense probably null
R1567:Nup85 UTSW 11 115568398 missense possibly damaging 0.83
R1774:Nup85 UTSW 11 115582945 missense probably benign 0.01
R1846:Nup85 UTSW 11 115568413 missense probably benign 0.11
R2084:Nup85 UTSW 11 115568691 missense possibly damaging 0.71
R4766:Nup85 UTSW 11 115577925 splice site probably null
R5748:Nup85 UTSW 11 115580512 missense probably damaging 1.00
R6362:Nup85 UTSW 11 115583734 missense probably damaging 0.98
R6906:Nup85 UTSW 11 115580943 missense probably damaging 1.00
R6951:Nup85 UTSW 11 115582955 missense possibly damaging 0.95
R7835:Nup85 UTSW 11 115570071 missense probably benign 0.35
R8125:Nup85 UTSW 11 115578237 frame shift probably null
R8151:Nup85 UTSW 11 115577933 missense probably benign 0.06
R8415:Nup85 UTSW 11 115566642 missense probably benign
R8517:Nup85 UTSW 11 115564564 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGGAAGTTTCTGGTTTTCTCAC -3'
(R):5'- ATGGCTGACCCCAGATTGTC -3'

Sequencing Primer
(F):5'- TCTCACTTAGCTGTAGATTGAGTAC -3'
(R):5'- GCTGACCCCAGATTGTCAATGAG -3'
Posted On2014-06-23