Mutagenetix > Incidental Mutations

Incidental Mutation 'R1851:Grk6'

208129

Institutional Source

Beutler Lab

Gene Symbol

Grk6

Ensembl Gene

ENSMUSG00000074886

Gene Name

G protein-coupled receptor kinase 6

Synonyms

Gprk6

MMRRC Submission

039875-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1851 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55445072-55460927 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 55451778 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 225 (R225*)

Ref Sequence

ENSEMBL: ENSMUSP00000153668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001115] [ENSMUST00000099482] [ENSMUST00000224118] [ENSMUST00000224653] [ENSMUST00000224995] [ENSMUST00000225925]

Predicted Effect

probably null
Transcript: ENSMUST00000001115
AA Change: R225*

SMART Domains

Protein: ENSMUSP00000001115
Gene: ENSMUSG00000074886
AA Change: R225*

Domain	Start	End	E-Value	Type
low complexity region	14	31	N/A	INTRINSIC
RGS	52	171	1.81e-34	SMART
S_TKc	186	448	8.4e-90	SMART
S_TK_X	449	528	2.8e-8	SMART
low complexity region	572	584	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000099482
AA Change: R225*

SMART Domains

Protein: ENSMUSP00000097081
Gene: ENSMUSG00000074886
AA Change: R225*

Domain	Start	End	E-Value	Type
low complexity region	14	31	N/A	INTRINSIC
RGS	52	171	1.81e-34	SMART
S_TKc	186	448	8.4e-90	SMART
S_TK_X	449	528	2.8e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185186

Predicted Effect

probably null
Transcript: ENSMUST00000224118
AA Change: R225*

Predicted Effect

probably null
Transcript: ENSMUST00000224653
AA Change: R193*

Predicted Effect

probably null
Transcript: ENSMUST00000224995
AA Change: R220*

Predicted Effect

probably null
Transcript: ENSMUST00000225925
AA Change: R225*

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Whereas, homozygous mutant mice are viable and show no gross anatomical or behavioral abnormalites under normal physiological conditions, they exhibit locomotor supersensitivity to psychostimulants including cocaine and amphetamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	A	G	12: 18,533,686	E225G	possibly damaging	Het
Abcb7	T	C	X: 104,305,399	M153V	probably benign	Het
Abi1	A	T	2: 22,950,264	V329D	possibly damaging	Het
Ablim3	G	A	18: 61,849,395	H160Y	probably benign	Het
Acox3	A	T	5: 35,609,062	D624V	possibly damaging	Het
Adam6b	A	G	12: 113,491,822	D753G	probably benign	Het
Ago1	C	A	4: 126,439,995	R771L	probably benign	Het
Aktip	A	G	8: 91,125,877	V217A	possibly damaging	Het
Ankk1	A	C	9: 49,415,850	H676Q	probably benign	Het
Arl1	G	C	10: 88,733,546		probably benign	Het
Asxl3	T	A	18: 22,517,739	D928E	probably damaging	Het
AW209491	T	C	13: 14,636,733	V57A	possibly damaging	Het
B3galt4	G	T	17: 33,950,911	Q118K	probably benign	Het
Ccdc187	A	T	2: 26,276,068	M783K	probably benign	Het
Cdon	T	G	9: 35,483,158	M900R	probably damaging	Het
Ceacam5	G	A	7: 17,714,910	W67*	probably null	Het
Chd5	A	G	4: 152,378,270	S1356G	probably damaging	Het
Chil3	C	T	3: 106,148,801		probably null	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cntn1	C	T	15: 92,305,140	R768C	probably damaging	Het
Col6a3	T	A	1: 90,807,534	I798F	possibly damaging	Het
Cpxcr1	T	A	X: 116,478,061	L223*	probably null	Het
Cpz	C	A	5: 35,502,558	R581L	possibly damaging	Het
Cxcr2	A	G	1: 74,159,279	I311V	probably benign	Het
Cym	T	A	3: 107,218,714	I78F	probably benign	Het
Defb8	A	T	8: 19,445,883	S54T	probably benign	Het
Dennd4a	A	G	9: 64,862,030	T433A	probably damaging	Het
Dhx29	A	G	13: 112,948,281	T678A	probably damaging	Het
Dspp	T	C	5: 104,174,085		probably null	Het
Enkur	G	T	2: 21,189,177	A195E	probably benign	Het
Ero1lb	T	A	13: 12,604,403	S429T	possibly damaging	Het
Fh1	A	G	1: 175,607,886	S344P	probably damaging	Het
Flnc	G	T	6: 29,443,479	G553V	probably damaging	Het
Fmo1	A	T	1: 162,829,985	L529*	probably null	Het
Frem1	C	A	4: 82,950,500	V1415F	probably damaging	Het
Gatb	T	G	3: 85,618,877	L354R	probably damaging	Het
Gdpgp1	A	T	7: 80,238,601	N127Y	probably damaging	Het
Gm11492	T	A	11: 87,568,915	D496E	probably damaging	Het
Gm13084	T	C	4: 143,812,826	I32M	probably benign	Het
Gm13212	T	G	4: 145,624,250		probably benign	Het
Gpat2	A	G	2: 127,434,819	T648A	possibly damaging	Het
Hells	A	T	19: 38,959,676	Q682L	probably null	Het
Hspa5	T	A	2: 34,774,678	N381K	possibly damaging	Het
Ighmbp2	T	C	19: 3,262,075	N893S	probably benign	Het
Ipo11	A	T	13: 106,812,257	V914E	possibly damaging	Het
Lars	T	C	18: 42,212,608	N1001S	probably benign	Het
Lats2	A	G	14: 57,697,455	L606P	probably damaging	Het
Map4k1	T	C	7: 28,999,784	Y521H	probably benign	Het
March11	T	A	15: 26,387,830	V257E	probably damaging	Het
Med23	G	A	10: 24,910,870		probably null	Het
Meltf	A	G	16: 31,896,577	D696G	probably benign	Het
Ms4a7	T	A	19: 11,324,424	M212L	probably benign	Het
Mx1	A	T	16: 97,448,203	L608Q	probably damaging	Het
Myh1	T	C	11: 67,204,398	Y195H	probably damaging	Het
Napb	G	T	2: 148,706,989	H110Q	probably benign	Het
Ngly1	C	T	14: 16,260,585	P90S	probably damaging	Het
Nlrp1b	T	A	11: 71,182,616	I134L	possibly damaging	Het
Nup210	A	G	6: 91,016,054	L1017P	probably damaging	Het
Nup85	T	A	11: 115,581,817	I233N	probably damaging	Het
Obsl1	A	G	1: 75,492,893	V965A	probably damaging	Het
Olfr1259	A	C	2: 89,943,814	Y100*	probably null	Het
Olfr1310	T	C	2: 112,008,691	D165G	probably benign	Het
Olfr787	T	C	10: 129,463,501	L275P	probably damaging	Het
Pak1ip1	A	G	13: 41,011,232	T264A	possibly damaging	Het
Pard6g	C	T	18: 80,117,142	R157C	probably damaging	Het
Pcdhb7	A	T	18: 37,342,578	T256S	possibly damaging	Het
Phrf1	T	C	7: 141,240,918	F153L	probably damaging	Het
Pigw	A	T	11: 84,878,048	F152I	probably damaging	Het
Pip4k2c	A	G	10: 127,200,875	S222P	probably damaging	Het
Pjvk	A	G	2: 76,657,431		probably null	Het
Plxnd1	C	T	6: 115,963,914	V1355M	probably damaging	Het
Prss22	G	A	17: 23,996,314	P163S	probably damaging	Het
Prune2	A	G	19: 17,199,139	I154V	probably damaging	Het
Rapgef6	T	A	11: 54,642,811	D362E	probably benign	Het
Retreg2	A	G	1: 75,146,675	K416E	probably benign	Het
Scn7a	T	C	2: 66,680,291	I1256V	probably benign	Het
Sema4d	A	G	13: 51,711,222	V362A	possibly damaging	Het
Slc25a34	G	A	4: 141,622,268	T192I	probably benign	Het
Tacc3	G	T	5: 33,668,200	V425L	probably benign	Het
Tfdp2	A	T	9: 96,297,709	K125I	probably damaging	Het
Tjp2	C	T	19: 24,099,535	R952Q	possibly damaging	Het
Tk2	G	T	8: 104,248,445	S30*	probably null	Het
Tmem74	A	T	15: 43,867,163	D161E	probably benign	Het
Tmprss9	G	A	10: 80,892,285	V570M	probably damaging	Het
Tnk2	C	A	16: 32,679,462	P26Q	probably damaging	Het
Tnpo2	T	G	8: 85,051,772	V610G	probably damaging	Het
Trim37	T	C	11: 87,218,306	F953S	probably damaging	Het
U2surp	T	A	9: 95,482,097	K589*	probably null	Het
Usp2	G	A	9: 44,075,966	R187H	probably benign	Het
Vmn2r1	C	T	3: 64,101,505	T535I	probably benign	Het
Wdr20rt	T	A	12: 65,227,151	S463T	possibly damaging	Het
Zbtb25	C	A	12: 76,349,714	G245W	probably damaging	Het
Zc3h14	T	A	12: 98,760,354	L27*	probably null	Het
Zfp2	T	C	11: 50,901,088	K43E	probably benign	Het
Zfp654	A	G	16: 64,785,128	Y904H	probably benign	Het

Other mutations in Grk6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01733:Grk6	APN	13	55451391	missense	possibly damaging	0.92
IGL02054:Grk6	APN	13	55454397	missense	probably benign	0.03
IGL02156:Grk6	APN	13	55449361	missense	possibly damaging	0.86
IGL02442:Grk6	APN	13	55458937	splice site	probably benign
IGL02750:Grk6	APN	13	55451543	missense	probably damaging	1.00
IGL03340:Grk6	APN	13	55453190	missense	probably damaging	1.00
Damper	UTSW	13	55458920	missense	probably damaging	1.00
Piano	UTSW	13	55454527	critical splice donor site	probably null
R0080:Grk6	UTSW	13	55458910	missense	probably benign	0.00
R1077:Grk6	UTSW	13	55454527	critical splice donor site	probably null
R1530:Grk6	UTSW	13	55458799	missense	probably damaging	0.99
R1531:Grk6	UTSW	13	55452154	missense	probably damaging	1.00
R1733:Grk6	UTSW	13	55453166	splice site	probably benign
R1874:Grk6	UTSW	13	55450273	missense	probably damaging	1.00
R2142:Grk6	UTSW	13	55454364	missense	probably damaging	1.00
R2875:Grk6	UTSW	13	55452304	missense	probably damaging	1.00
R5187:Grk6	UTSW	13	55451706	missense	probably damaging	1.00
R7010:Grk6	UTSW	13	55450300	missense	possibly damaging	0.74
R7104:Grk6	UTSW	13	55454406	missense	probably benign	0.36
R7111:Grk6	UTSW	13	55458920	missense	probably damaging	1.00
R7769:Grk6	UTSW	13	55451007	missense	probably benign	0.01
R7982:Grk6	UTSW	13	55451706	missense	probably damaging	1.00
R8401:Grk6	UTSW	13	55452168	missense	possibly damaging	0.95
R8468:Grk6	UTSW	13	55451385	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGAGTATAGTAGATTGGGTAC -3'
(R):5'- TCCTGAGCCTGGAATAGCAC -3'

Sequencing Primer
(F):5'- ATAGTAGATTGGGTACTTGTAGGCCC -3'
(R):5'- TGAGCCTGGAATAGCACTCCTAC -3'

Posted On

2014-06-23