Mutagenetix > Incidental Mutation

Incidental Mutation 'R1851:Prune2'

208153

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

MMRRC Submission

039875-MU

Accession Numbers

Genbank: NM_181348

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1851 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17199139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 154 (I154V)

Ref Sequence

ENSEMBL: ENSMUSP00000153135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689] [ENSMUST00000223920] [ENSMUST00000225351]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087689
AA Change: I2903V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: I2903V

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223920
AA Change: I154V

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224059

Predicted Effect

probably damaging
Transcript: ENSMUST00000225351
AA Change: I154V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000226052
AA Change: I180V

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	A	G	12: 18,533,686	E225G	possibly damaging	Het
Abcb7	T	C	X: 104,305,399	M153V	probably benign	Het
Abi1	A	T	2: 22,950,264	V329D	possibly damaging	Het
Ablim3	G	A	18: 61,849,395	H160Y	probably benign	Het
Acox3	A	T	5: 35,609,062	D624V	possibly damaging	Het
Adam6b	A	G	12: 113,491,822	D753G	probably benign	Het
Ago1	C	A	4: 126,439,995	R771L	probably benign	Het
Aktip	A	G	8: 91,125,877	V217A	possibly damaging	Het
Ankk1	A	C	9: 49,415,850	H676Q	probably benign	Het
Arl1	G	C	10: 88,733,546		probably benign	Het
Asxl3	T	A	18: 22,517,739	D928E	probably damaging	Het
AW209491	T	C	13: 14,636,733	V57A	possibly damaging	Het
B3galt4	G	T	17: 33,950,911	Q118K	probably benign	Het
Ccdc187	A	T	2: 26,276,068	M783K	probably benign	Het
Cdon	T	G	9: 35,483,158	M900R	probably damaging	Het
Ceacam5	G	A	7: 17,714,910	W67*	probably null	Het
Chd5	A	G	4: 152,378,270	S1356G	probably damaging	Het
Chil3	C	T	3: 106,148,801		probably null	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cntn1	C	T	15: 92,305,140	R768C	probably damaging	Het
Col6a3	T	A	1: 90,807,534	I798F	possibly damaging	Het
Cpxcr1	T	A	X: 116,478,061	L223*	probably null	Het
Cpz	C	A	5: 35,502,558	R581L	possibly damaging	Het
Cxcr2	A	G	1: 74,159,279	I311V	probably benign	Het
Cym	T	A	3: 107,218,714	I78F	probably benign	Het
Defb8	A	T	8: 19,445,883	S54T	probably benign	Het
Dennd4a	A	G	9: 64,862,030	T433A	probably damaging	Het
Dhx29	A	G	13: 112,948,281	T678A	probably damaging	Het
Dspp	T	C	5: 104,174,085		probably null	Het
Enkur	G	T	2: 21,189,177	A195E	probably benign	Het
Ero1lb	T	A	13: 12,604,403	S429T	possibly damaging	Het
Fh1	A	G	1: 175,607,886	S344P	probably damaging	Het
Flnc	G	T	6: 29,443,479	G553V	probably damaging	Het
Fmo1	A	T	1: 162,829,985	L529*	probably null	Het
Frem1	C	A	4: 82,950,500	V1415F	probably damaging	Het
Gatb	T	G	3: 85,618,877	L354R	probably damaging	Het
Gdpgp1	A	T	7: 80,238,601	N127Y	probably damaging	Het
Gm11492	T	A	11: 87,568,915	D496E	probably damaging	Het
Gm13084	T	C	4: 143,812,826	I32M	probably benign	Het
Gm13212	T	G	4: 145,624,250		probably benign	Het
Gpat2	A	G	2: 127,434,819	T648A	possibly damaging	Het
Grk6	C	T	13: 55,451,778	R225*	probably null	Het
Hells	A	T	19: 38,959,676	Q682L	probably null	Het
Hspa5	T	A	2: 34,774,678	N381K	possibly damaging	Het
Ighmbp2	T	C	19: 3,262,075	N893S	probably benign	Het
Ipo11	A	T	13: 106,812,257	V914E	possibly damaging	Het
Lars	T	C	18: 42,212,608	N1001S	probably benign	Het
Lats2	A	G	14: 57,697,455	L606P	probably damaging	Het
Map4k1	T	C	7: 28,999,784	Y521H	probably benign	Het
March11	T	A	15: 26,387,830	V257E	probably damaging	Het
Med23	G	A	10: 24,910,870		probably null	Het
Meltf	A	G	16: 31,896,577	D696G	probably benign	Het
Ms4a7	T	A	19: 11,324,424	M212L	probably benign	Het
Mx1	A	T	16: 97,448,203	L608Q	probably damaging	Het
Myh1	T	C	11: 67,204,398	Y195H	probably damaging	Het
Napb	G	T	2: 148,706,989	H110Q	probably benign	Het
Ngly1	C	T	14: 16,260,585	P90S	probably damaging	Het
Nlrp1b	T	A	11: 71,182,616	I134L	possibly damaging	Het
Nup210	A	G	6: 91,016,054	L1017P	probably damaging	Het
Nup85	T	A	11: 115,581,817	I233N	probably damaging	Het
Obsl1	A	G	1: 75,492,893	V965A	probably damaging	Het
Olfr1259	A	C	2: 89,943,814	Y100*	probably null	Het
Olfr1310	T	C	2: 112,008,691	D165G	probably benign	Het
Olfr787	T	C	10: 129,463,501	L275P	probably damaging	Het
Pak1ip1	A	G	13: 41,011,232	T264A	possibly damaging	Het
Pard6g	C	T	18: 80,117,142	R157C	probably damaging	Het
Pcdhb7	A	T	18: 37,342,578	T256S	possibly damaging	Het
Phrf1	T	C	7: 141,240,918	F153L	probably damaging	Het
Pigw	A	T	11: 84,878,048	F152I	probably damaging	Het
Pip4k2c	A	G	10: 127,200,875	S222P	probably damaging	Het
Pjvk	A	G	2: 76,657,431		probably null	Het
Plxnd1	C	T	6: 115,963,914	V1355M	probably damaging	Het
Prss22	G	A	17: 23,996,314	P163S	probably damaging	Het
Rapgef6	T	A	11: 54,642,811	D362E	probably benign	Het
Retreg2	A	G	1: 75,146,675	K416E	probably benign	Het
Scn7a	T	C	2: 66,680,291	I1256V	probably benign	Het
Sema4d	A	G	13: 51,711,222	V362A	possibly damaging	Het
Slc25a34	G	A	4: 141,622,268	T192I	probably benign	Het
Tacc3	G	T	5: 33,668,200	V425L	probably benign	Het
Tfdp2	A	T	9: 96,297,709	K125I	probably damaging	Het
Tjp2	C	T	19: 24,099,535	R952Q	possibly damaging	Het
Tk2	G	T	8: 104,248,445	S30*	probably null	Het
Tmem74	A	T	15: 43,867,163	D161E	probably benign	Het
Tmprss9	G	A	10: 80,892,285	V570M	probably damaging	Het
Tnk2	C	A	16: 32,679,462	P26Q	probably damaging	Het
Tnpo2	T	G	8: 85,051,772	V610G	probably damaging	Het
Trim37	T	C	11: 87,218,306	F953S	probably damaging	Het
U2surp	T	A	9: 95,482,097	K589*	probably null	Het
Usp2	G	A	9: 44,075,966	R187H	probably benign	Het
Vmn2r1	C	T	3: 64,101,505	T535I	probably benign	Het
Wdr20rt	T	A	12: 65,227,151	S463T	possibly damaging	Het
Zbtb25	C	A	12: 76,349,714	G245W	probably damaging	Het
Zc3h14	T	A	12: 98,760,354	L27*	probably null	Het
Zfp2	T	C	11: 50,901,088	K43E	probably benign	Het
Zfp654	A	G	16: 64,785,128	Y904H	probably benign	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0531:Prune2	UTSW	19	17006753	missense	probably damaging	1.00
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0554:Prune2	UTSW	19	17125218	nonsense	probably null
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1838:Prune2	UTSW	19	17199878	missense	probably damaging	1.00
R1852:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1911:Prune2	UTSW	19	17113674	missense	probably benign	0.02
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2111:Prune2	UTSW	19	17208238	missense	probably damaging	1.00
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4022:Prune2	UTSW	19	17000020	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4922:Prune2	UTSW	19	17122752	missense	probably benign	0.00
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
R7872:Prune2	UTSW	19	17119434	missense	probably benign	0.05
R7881:Prune2	UTSW	19	17123029	missense	possibly damaging	0.50
R7966:Prune2	UTSW	19	17178859	missense	probably damaging	0.99
R7969:Prune2	UTSW	19	17201670	missense	probably damaging	0.98
R8092:Prune2	UTSW	19	17119993	missense	probably damaging	1.00
R8110:Prune2	UTSW	19	17120719	missense	probably benign	0.22
R8115:Prune2	UTSW	19	17123924	missense	probably benign	0.02
R8129:Prune2	UTSW	19	17118836	missense	probably benign	0.01
R8169:Prune2	UTSW	19	17125091	missense	probably benign	0.10
R8171:Prune2	UTSW	19	17120518	missense	probably damaging	1.00
R8176:Prune2	UTSW	19	17118292	missense	probably damaging	1.00
R8200:Prune2	UTSW	19	17124973	missense	probably benign	0.01
R8217:Prune2	UTSW	19	17120116	missense	probably benign	0.01
R8258:Prune2	UTSW	19	17212308	missense	unknown
R8259:Prune2	UTSW	19	17212308	missense	unknown
R8289:Prune2	UTSW	19	17123009	missense	probably benign	0.43
R8329:Prune2	UTSW	19	17121265	missense	probably benign	0.02
R8342:Prune2	UTSW	19	17125663	missense	probably benign	0.01
R8558:Prune2	UTSW	19	17122238	missense	probably damaging	0.98
R8732:Prune2	UTSW	19	17120405	missense	probably damaging	1.00
R8743:Prune2	UTSW	19	17119556	missense	probably benign	0.22
R8769:Prune2	UTSW	19	17123078	missense	probably damaging	0.96
R8862:Prune2	UTSW	19	17120146	missense	probably benign	0.04
R8936:Prune2	UTSW	19	17121835	missense	probably benign	0.24
R9040:Prune2	UTSW	19	17120627	missense	probably damaging	1.00
R9084:Prune2	UTSW	19	17120377	missense	probably damaging	1.00
R9224:Prune2	UTSW	19	17120029	missense	probably damaging	1.00
R9273:Prune2	UTSW	19	17118326	missense	possibly damaging	0.74
R9275:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9278:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9290:Prune2	UTSW	19	17168327	missense	probably benign	0.41
R9305:Prune2	UTSW	19	17120261	missense	probably benign	0.14
R9317:Prune2	UTSW	19	17121670	missense	probably benign	0.00
R9354:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R9373:Prune2	UTSW	19	17122138	missense	probably benign
R9394:Prune2	UTSW	19	17003689	missense	probably damaging	1.00
R9405:Prune2	UTSW	19	17216344	missense	probably damaging	0.99
R9476:Prune2	UTSW	19	17119342	missense	possibly damaging	0.64
R9532:Prune2	UTSW	19	17122430	missense	probably benign	0.00
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTACCCCTCACTATGCTTG -3'
(R):5'- ACAGAGTTCCCTAGGGCAAG -3'

Sequencing Primer
(F):5'- GCTTGCTCATTTTATGATACAGTGC -3'
(R):5'- AGGCTCTGTGACTGAAATCC -3'

Posted On

2014-06-23