Incidental Mutation 'R1852:Mme'
ID208176
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Namemembrane metallo endopeptidase
SynonymsCD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik
MMRRC Submission 039876-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1852 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location63241537-63386030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63327983 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 97 (S97G)
Ref Sequence ENSEMBL: ENSMUSP00000141469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000191633] [ENSMUST00000192002] [ENSMUST00000194134] [ENSMUST00000194150] [ENSMUST00000194324] [ENSMUST00000194836]
Predicted Effect probably benign
Transcript: ENSMUST00000029400
AA Change: S151G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: S151G

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191633
AA Change: S97G

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141469
Gene: ENSMUSG00000027820
AA Change: S97G

DomainStartEndE-ValueType
Pfam:Peptidase_M13_N 14 130 3.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192002
AA Change: S151G

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141483
Gene: ENSMUSG00000027820
AA Change: S151G

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 1e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 178 1.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193805
Predicted Effect probably benign
Transcript: ENSMUST00000194134
AA Change: S151G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: S151G

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194150
AA Change: S151G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: S151G

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194324
SMART Domains Protein: ENSMUSP00000142259
Gene: ENSMUSG00000027820

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-8 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 131 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194836
AA Change: S151G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141452
Gene: ENSMUSG00000027820
AA Change: S151G

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 1e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 187 5.6e-33 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,268,473 D499G probably damaging Het
2900092C05Rik A G 7: 12,512,702 probably null Het
4930433I11Rik T A 7: 40,993,613 D326E probably benign Het
A530032D15Rik G A 1: 85,085,131 probably benign Het
Abca8a T C 11: 110,069,386 D676G probably damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acsl6 T C 11: 54,361,076 I683T probably damaging Het
Adgrg5 A T 8: 94,937,800 Y345F probably damaging Het
Alg6 T G 4: 99,746,362 F114V probably benign Het
Ank2 A C 3: 126,997,851 probably null Het
Ankrd24 A T 10: 81,642,941 probably benign Het
Ano8 T C 8: 71,483,487 K222E probably damaging Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Bmpr1b A T 3: 141,857,402 probably null Het
C3 A G 17: 57,222,823 V2A probably damaging Het
Capn1 A G 19: 6,009,103 V276A possibly damaging Het
Ccdc57 T C 11: 120,921,673 E85G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chl1 A T 6: 103,699,159 probably null Het
Chodl C T 16: 78,941,258 P38L probably benign Het
Clec4a2 G T 6: 123,139,125 E124* probably null Het
Cmtr1 T C 17: 29,702,255 V825A probably benign Het
Cnksr3 T C 10: 7,120,539 I232V probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col15a1 G T 4: 47,299,278 probably null Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cul1 A G 6: 47,520,830 N615S probably damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cyp2c67 C T 19: 39,617,367 G362S probably benign Het
D930048N14Rik T A 11: 51,653,865 probably benign Het
Ddx49 T C 8: 70,300,983 T79A probably damaging Het
Defb46 T A 8: 19,239,975 probably null Het
Dnah17 T A 11: 118,121,916 I145F probably damaging Het
Dock8 A T 19: 25,127,128 I725F probably benign Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Enam T A 5: 88,504,465 S1278T possibly damaging Het
Fndc3a A G 14: 72,556,843 V829A probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gm10787 A T 10: 77,021,877 noncoding transcript Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gsap T A 5: 21,290,545 probably null Het
Gtf2ird1 T C 5: 134,382,580 probably null Het
Has3 A T 8: 106,874,079 I58F probably damaging Het
Haus5 A T 7: 30,658,501 probably null Het
Hip1r T C 5: 123,991,505 V169A probably benign Het
Hnf1a T A 5: 114,970,711 D45V probably damaging Het
Il20ra T A 10: 19,743,019 Y72N probably damaging Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Itpr1 T C 6: 108,386,706 L763P probably damaging Het
Katnal2 C A 18: 77,016,023 R104L probably benign Het
Kcng4 G T 8: 119,626,208 P321Q probably benign Het
Larp4b T C 13: 9,137,303 probably null Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lhcgr T A 17: 88,765,176 I148F probably damaging Het
Lsm10 T A 4: 126,097,963 S37R possibly damaging Het
Mfsd13a A G 19: 46,372,180 probably null Het
Mipep T A 14: 60,843,240 C560* probably null Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myt1l T C 12: 29,851,661 M208T probably benign Het
Neb T C 2: 52,228,542 I3987V probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Neto1 T C 18: 86,395,884 M1T probably null Het
Nom1 T C 5: 29,446,878 F738S possibly damaging Het
Olfr1137 T C 2: 87,710,973 probably null Het
Olfr1160 T G 2: 88,006,521 I86L probably damaging Het
Olfr1314 C A 2: 112,091,847 V285L probably benign Het
Olfr1420 C A 19: 11,896,885 P288H probably damaging Het
Olfr1487 C T 19: 13,619,603 S147F probably damaging Het
Olfr523 T A 7: 140,176,561 L147* probably null Het
Olfr572 C T 7: 102,928,441 S271L probably damaging Het
Olfr772 T C 10: 129,174,328 K231R probably benign Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Palb2 G T 7: 122,114,314 D915E possibly damaging Het
Pank4 T C 4: 154,976,359 L491P probably damaging Het
Paqr7 T C 4: 134,507,669 V279A probably benign Het
Pcif1 G A 2: 164,888,466 R373Q probably damaging Het
Pdgfa T A 5: 138,979,172 N185I probably benign Het
Plcd4 T C 1: 74,549,361 V123A possibly damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rac3 T G 11: 120,723,494 L148R possibly damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Rbl1 A G 2: 157,174,903 I592T probably benign Het
Rbl2 A C 8: 91,095,563 D408A possibly damaging Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Rorb A T 19: 18,962,083 L234H probably damaging Het
Rpp40 T G 13: 35,896,914 D279A probably benign Het
Siglec1 C A 2: 131,081,500 V442L probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skiv2l2 A T 13: 112,872,927 H979Q probably benign Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Sptbn5 T C 2: 120,071,644 I126M possibly damaging Het
Strada A G 11: 106,171,221 V94A possibly damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Tcrg-C3 A T 13: 19,261,091 M70L probably damaging Het
Tgm1 T C 14: 55,704,941 Y651C probably damaging Het
Tmem200c T A 17: 68,840,617 V65E probably damaging Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Vcan T G 13: 89,705,392 E483A probably damaging Het
Vmn2r124 A G 17: 18,063,174 T377A probably benign Het
Vmn2r3 A C 3: 64,259,394 I772S probably damaging Het
Wdfy3 A G 5: 101,915,376 V1342A probably benign Het
Zfp507 T C 7: 35,787,751 H764R probably damaging Het
Znrf3 A G 11: 5,287,455 I218T possibly damaging Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63340044 missense possibly damaging 0.95
IGL00329:Mme APN 3 63380328 nonsense probably null
IGL01013:Mme APN 3 63327860 unclassified probably null
IGL01316:Mme APN 3 63340159 splice site probably benign
IGL01333:Mme APN 3 63346091 missense probably damaging 1.00
IGL01392:Mme APN 3 63362046 missense probably damaging 1.00
IGL01566:Mme APN 3 63361929 splice site probably benign
IGL01739:Mme APN 3 63340113 missense possibly damaging 0.78
IGL01996:Mme APN 3 63343549 missense probably benign 0.11
IGL02125:Mme APN 3 63348649 missense probably damaging 1.00
IGL02154:Mme APN 3 63343555 missense probably benign
IGL03214:Mme APN 3 63329690 missense possibly damaging 0.72
IGL03291:Mme APN 3 63346104 missense probably benign 0.00
R0498:Mme UTSW 3 63346066 missense probably damaging 1.00
R0595:Mme UTSW 3 63328181 missense probably benign 0.27
R0980:Mme UTSW 3 63340129 missense probably benign
R1210:Mme UTSW 3 63343606 missense probably benign 0.01
R1600:Mme UTSW 3 63365058 missense probably damaging 1.00
R1852:Mme UTSW 3 63328046 missense probably benign 0.00
R2037:Mme UTSW 3 63328260 missense probably null 1.00
R2177:Mme UTSW 3 63301005 missense probably benign 0.02
R2200:Mme UTSW 3 63380292 missense possibly damaging 0.87
R2306:Mme UTSW 3 63300252 missense probably benign 0.00
R2847:Mme UTSW 3 63345199 missense possibly damaging 0.91
R3008:Mme UTSW 3 63358957 missense probably damaging 1.00
R3749:Mme UTSW 3 63343540 missense probably damaging 1.00
R3876:Mme UTSW 3 63362059 splice site probably benign
R3961:Mme UTSW 3 63345192 missense probably damaging 1.00
R3981:Mme UTSW 3 63328064 missense probably damaging 1.00
R3982:Mme UTSW 3 63328064 missense probably damaging 1.00
R3983:Mme UTSW 3 63328064 missense probably damaging 1.00
R4494:Mme UTSW 3 63347192 missense probably benign
R4589:Mme UTSW 3 63380272 missense probably benign
R4706:Mme UTSW 3 63348712 missense possibly damaging 0.92
R4871:Mme UTSW 3 63340032 missense probably benign 0.01
R4957:Mme UTSW 3 63343489 splice site probably benign
R5053:Mme UTSW 3 63364849 missense probably damaging 1.00
R5316:Mme UTSW 3 63368954 missense probably damaging 1.00
R5502:Mme UTSW 3 63300281 nonsense probably null
R5579:Mme UTSW 3 63348645 missense probably damaging 1.00
R6007:Mme UTSW 3 63343508 nonsense probably null
R6022:Mme UTSW 3 63364797 missense probably damaging 1.00
R6143:Mme UTSW 3 63300111 splice site probably null
R6154:Mme UTSW 3 63300253 missense probably damaging 0.98
R6333:Mme UTSW 3 63341961 missense probably benign 0.00
R6476:Mme UTSW 3 63343635 critical splice donor site probably null
R6514:Mme UTSW 3 63364844 nonsense probably null
R6711:Mme UTSW 3 63341918 missense possibly damaging 0.93
R6842:Mme UTSW 3 63362044 missense probably damaging 1.00
R6996:Mme UTSW 3 63346102 missense possibly damaging 0.63
R7040:Mme UTSW 3 63368923 missense probably damaging 1.00
R7043:Mme UTSW 3 63345217 nonsense probably null
R7084:Mme UTSW 3 63328217 missense probably damaging 0.98
R7126:Mme UTSW 3 63368901 missense probably damaging 0.97
R7783:Mme UTSW 3 63364867 missense probably damaging 1.00
X0058:Mme UTSW 3 63365021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGTCCTTCAAGAACCCAAAACTG -3'
(R):5'- TCAGCTGTCCAAGAAGTGC -3'

Sequencing Primer
(F):5'- ACTGAAGACATAGTAGCAGTGC -3'
(R):5'- GCTGTCCAAGAAGTGCCTAAAGTAC -3'
Posted On2014-06-23