Incidental Mutation 'R0116:Med13'
ID 20822
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms 1110067M05Rik, Thrap1, Trap240
MMRRC Submission 038402-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R0116 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 86157859-86248422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86210723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 473 (L473S)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect probably damaging
Transcript: ENSMUST00000043624
AA Change: L473S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: L473S

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Meta Mutation Damage Score 0.0649 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 94% (95/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,202,066 (GRCm39) V152E probably damaging Het
Abca5 T G 11: 110,167,331 (GRCm39) E1495A probably damaging Het
Abcc12 G A 8: 87,261,627 (GRCm39) S668F probably benign Het
Adgrl4 A T 3: 151,223,247 (GRCm39) T608S probably benign Het
Angel2 G A 1: 190,673,187 (GRCm39) D255N probably benign Het
Apob T A 12: 8,039,113 (GRCm39) probably benign Het
Arfgef2 A T 2: 166,715,603 (GRCm39) R1349S probably damaging Het
Atp2b2 C T 6: 113,770,656 (GRCm39) V418I probably damaging Het
Birc6 C A 17: 74,930,741 (GRCm39) probably benign Het
Capn13 T A 17: 73,658,519 (GRCm39) Y183F probably damaging Het
Cngb1 A G 8: 95,987,266 (GRCm39) S352P probably damaging Het
Col6a3 A G 1: 90,741,273 (GRCm39) S720P probably damaging Het
Cpa4 C T 6: 30,579,657 (GRCm39) R155W probably damaging Het
Dapk1 A G 13: 60,908,914 (GRCm39) I1176V probably benign Het
Dnah17 T C 11: 117,949,132 (GRCm39) E2959G probably benign Het
Dnah7b T A 1: 46,252,520 (GRCm39) I1734N possibly damaging Het
Dnajb7 A G 15: 81,291,555 (GRCm39) Y261H probably benign Het
Dock2 T C 11: 34,579,392 (GRCm39) probably benign Het
Dyrk3 A T 1: 131,057,576 (GRCm39) V199E probably damaging Het
F2r G T 13: 95,740,994 (GRCm39) C180* probably null Het
F5 A G 1: 164,012,483 (GRCm39) S466G probably benign Het
Fbn2 A T 18: 58,235,445 (GRCm39) C677* probably null Het
Fbxo41 A G 6: 85,454,890 (GRCm39) S673P probably damaging Het
Fhad1 G T 4: 141,667,406 (GRCm39) H639N probably benign Het
Fmnl3 G C 15: 99,220,619 (GRCm39) probably benign Het
Foxa2 A G 2: 147,885,481 (GRCm39) S270P probably damaging Het
Fxyd7 C T 7: 30,746,793 (GRCm39) probably null Het
Gm5225 A G 17: 24,243,032 (GRCm39) D67G probably benign Het
Grik3 G A 4: 125,564,349 (GRCm39) E444K probably benign Het
Gsdma2 A G 11: 98,540,009 (GRCm39) K44E probably damaging Het
Haus1 T A 18: 77,849,770 (GRCm39) K130* probably null Het
Heg1 A G 16: 33,556,028 (GRCm39) probably benign Het
Hormad2 A G 11: 4,362,206 (GRCm39) probably benign Het
Hsd17b3 G A 13: 64,206,403 (GRCm39) R300C possibly damaging Het
Irf5 T C 6: 29,536,108 (GRCm39) F374S probably damaging Het
Itch A G 2: 155,059,903 (GRCm39) probably benign Het
Jade2 A T 11: 51,722,136 (GRCm39) L139Q probably damaging Het
Kif5c G A 2: 49,642,251 (GRCm39) probably benign Het
Lama1 T C 17: 68,083,918 (GRCm39) Y1387H probably benign Het
Larp4b A G 13: 9,220,724 (GRCm39) R658G probably damaging Het
Mcph1 C T 8: 18,838,264 (GRCm39) L729F probably benign Het
Me1 A T 9: 86,536,720 (GRCm39) N118K probably benign Het
Mgam T A 6: 40,635,921 (GRCm39) Y359N probably damaging Het
Morc2b A G 17: 33,356,015 (GRCm39) S586P probably damaging Het
Mthfr A G 4: 148,135,980 (GRCm39) D310G probably benign Het
Mtmr7 A T 8: 41,034,447 (GRCm39) probably benign Het
Mtus1 A G 8: 41,451,514 (GRCm39) probably benign Het
Mus81 G T 19: 5,536,552 (GRCm39) A138D probably damaging Het
Myom2 A T 8: 15,167,633 (GRCm39) I1073F probably damaging Het
Nhsl1 A T 10: 18,400,990 (GRCm39) K739* probably null Het
Nlrp4d T A 7: 10,108,818 (GRCm39) K762N probably benign Het
Nrap T C 19: 56,343,978 (GRCm39) Y724C probably damaging Het
Ogn A T 13: 49,774,514 (GRCm39) Y219F possibly damaging Het
Or6c212 T A 10: 129,558,846 (GRCm39) D189V probably damaging Het
Or8b56 T C 9: 38,739,860 (GRCm39) L291P probably damaging Het
Or8g30 A T 9: 39,230,160 (GRCm39) I250N probably damaging Het
Padi2 T C 4: 140,653,550 (GRCm39) V180A probably benign Het
Papss2 C T 19: 32,615,768 (GRCm39) R167* probably null Het
Pcbp2 T C 15: 102,382,670 (GRCm39) probably benign Het
Per1 T A 11: 68,992,706 (GRCm39) probably benign Het
Pik3ca T C 3: 32,514,094 (GRCm39) I860T probably damaging Het
Pkdrej G A 15: 85,701,746 (GRCm39) Q1397* probably null Het
Plce1 T C 19: 38,710,265 (GRCm39) V1133A probably benign Het
Pnma8a T G 7: 16,694,625 (GRCm39) V160G probably damaging Het
Prss12 T C 3: 123,276,423 (GRCm39) C351R probably damaging Het
Qprt A T 7: 126,708,269 (GRCm39) L54Q probably damaging Het
Raf1 C T 6: 115,603,344 (GRCm39) S165N probably damaging Het
Rere A G 4: 150,701,433 (GRCm39) N1271S probably benign Het
Rnasel T A 1: 153,630,258 (GRCm39) L258H probably damaging Het
Ryr2 T C 13: 11,724,807 (GRCm39) D2502G probably damaging Het
Ryr3 G A 2: 112,633,510 (GRCm39) S2081L probably damaging Het
Sc5d G T 9: 42,171,155 (GRCm39) Y11* probably null Het
Slc25a29 A C 12: 108,793,017 (GRCm39) L187R possibly damaging Het
Slc2a7 G A 4: 150,252,721 (GRCm39) V454M probably benign Het
Slco1b2 A T 6: 141,615,114 (GRCm39) T340S probably benign Het
Smarcc1 A G 9: 109,976,172 (GRCm39) N153S possibly damaging Het
Snx1 C A 9: 65,995,821 (GRCm39) E516* probably null Het
Sptlc2 T C 12: 87,403,454 (GRCm39) D115G probably benign Het
Stard9 A G 2: 120,464,736 (GRCm39) N67S probably damaging Het
Styxl2 A C 1: 165,927,270 (GRCm39) S781A probably benign Het
Swap70 G A 7: 109,872,489 (GRCm39) R368H probably benign Het
Tcaf3 T C 6: 42,568,284 (GRCm39) K691E probably benign Het
Tmco4 T C 4: 138,781,231 (GRCm39) F465S probably damaging Het
Tmem245 A G 4: 56,926,213 (GRCm39) S290P probably benign Het
Top2a T C 11: 98,894,416 (GRCm39) T972A probably benign Het
Tpr T A 1: 150,285,898 (GRCm39) S527R probably damaging Het
Traf2 T C 2: 25,409,621 (GRCm39) D443G probably damaging Het
Trim40 A T 17: 37,194,039 (GRCm39) probably null Het
Trim42 A T 9: 97,245,456 (GRCm39) I448N possibly damaging Het
Ttll9 G A 2: 152,825,054 (GRCm39) V78M probably damaging Het
Vav1 C T 17: 57,603,039 (GRCm39) L88F probably damaging Het
Vps13b A G 15: 35,423,301 (GRCm39) D207G probably damaging Het
Wdsub1 A G 2: 59,707,009 (GRCm39) probably null Het
Zfp799 A G 17: 33,040,009 (GRCm39) W85R possibly damaging Het
Zfp839 A T 12: 110,825,203 (GRCm39) probably benign Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86,181,866 (GRCm39) splice site probably benign
IGL01391:Med13 APN 11 86,219,323 (GRCm39) missense probably benign
IGL01767:Med13 APN 11 86,210,609 (GRCm39) missense probably benign 0.38
IGL01830:Med13 APN 11 86,179,754 (GRCm39) splice site probably benign
IGL01859:Med13 APN 11 86,174,577 (GRCm39) missense possibly damaging 0.86
IGL01924:Med13 APN 11 86,199,522 (GRCm39) splice site probably benign
IGL02080:Med13 APN 11 86,174,638 (GRCm39) missense probably damaging 0.97
IGL02138:Med13 APN 11 86,177,591 (GRCm39) missense probably damaging 0.99
IGL02259:Med13 APN 11 86,248,327 (GRCm39) missense possibly damaging 0.89
IGL02339:Med13 APN 11 86,179,765 (GRCm39) missense probably benign 0.16
IGL02399:Med13 APN 11 86,174,771 (GRCm39) splice site probably benign
IGL02646:Med13 APN 11 86,174,212 (GRCm39) missense probably benign 0.00
IGL03227:Med13 APN 11 86,218,618 (GRCm39) splice site probably benign
R0197_Med13_854 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0360_Med13_060 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R2359_Med13_079 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R3735_Med13_085 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4974_Med13_508 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R0189:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R0197:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0206:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0208:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0310:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R0360:Med13 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R0413:Med13 UTSW 11 86,190,033 (GRCm39) splice site probably benign
R0482:Med13 UTSW 11 86,175,977 (GRCm39) missense probably benign 0.41
R0497:Med13 UTSW 11 86,167,809 (GRCm39) splice site probably benign
R0589:Med13 UTSW 11 86,174,075 (GRCm39) missense probably damaging 1.00
R0601:Med13 UTSW 11 86,236,788 (GRCm39) missense possibly damaging 0.47
R0646:Med13 UTSW 11 86,221,915 (GRCm39) missense possibly damaging 0.95
R0701:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0709:Med13 UTSW 11 86,210,422 (GRCm39) missense possibly damaging 0.95
R0711:Med13 UTSW 11 86,192,179 (GRCm39) splice site probably benign
R0734:Med13 UTSW 11 86,192,063 (GRCm39) missense probably benign
R0883:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R1793:Med13 UTSW 11 86,220,177 (GRCm39) missense probably benign 0.45
R1926:Med13 UTSW 11 86,179,899 (GRCm39) missense possibly damaging 0.47
R1959:Med13 UTSW 11 86,189,805 (GRCm39) missense probably damaging 1.00
R2286:Med13 UTSW 11 86,210,515 (GRCm39) missense probably benign 0.05
R2359:Med13 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R2444:Med13 UTSW 11 86,222,786 (GRCm39) missense probably damaging 1.00
R2679:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R2879:Med13 UTSW 11 86,189,988 (GRCm39) missense possibly damaging 0.61
R3439:Med13 UTSW 11 86,176,123 (GRCm39) missense probably damaging 1.00
R3735:Med13 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4333:Med13 UTSW 11 86,179,009 (GRCm39) missense probably benign
R4558:Med13 UTSW 11 86,189,880 (GRCm39) missense probably damaging 1.00
R4598:Med13 UTSW 11 86,169,392 (GRCm39) missense probably damaging 0.97
R4773:Med13 UTSW 11 86,167,746 (GRCm39) missense probably damaging 0.99
R4801:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4802:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4806:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R4940:Med13 UTSW 11 86,178,944 (GRCm39) missense probably damaging 1.00
R4974:Med13 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R5056:Med13 UTSW 11 86,219,391 (GRCm39) missense probably benign 0.00
R5133:Med13 UTSW 11 86,210,675 (GRCm39) missense probably benign 0.32
R5206:Med13 UTSW 11 86,210,705 (GRCm39) missense probably damaging 1.00
R5352:Med13 UTSW 11 86,192,294 (GRCm39) missense possibly damaging 0.82
R5534:Med13 UTSW 11 86,210,191 (GRCm39) missense probably benign 0.09
R5556:Med13 UTSW 11 86,218,664 (GRCm39) missense probably benign 0.25
R5633:Med13 UTSW 11 86,169,757 (GRCm39) splice site probably benign
R5769:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R6236:Med13 UTSW 11 86,219,357 (GRCm39) missense probably damaging 0.99
R6479:Med13 UTSW 11 86,248,353 (GRCm39) start gained probably benign
R6487:Med13 UTSW 11 86,221,976 (GRCm39) missense probably damaging 1.00
R6524:Med13 UTSW 11 86,192,293 (GRCm39) missense probably damaging 0.98
R6528:Med13 UTSW 11 86,189,780 (GRCm39) missense probably damaging 1.00
R6805:Med13 UTSW 11 86,169,622 (GRCm39) missense possibly damaging 0.48
R6913:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R7221:Med13 UTSW 11 86,178,921 (GRCm39) missense probably benign 0.00
R7254:Med13 UTSW 11 86,210,661 (GRCm39) missense probably benign
R7267:Med13 UTSW 11 86,199,652 (GRCm39) missense probably benign 0.01
R7309:Med13 UTSW 11 86,181,888 (GRCm39) missense probably benign 0.00
R7404:Med13 UTSW 11 86,177,272 (GRCm39) missense possibly damaging 0.53
R7586:Med13 UTSW 11 86,161,828 (GRCm39) missense probably damaging 0.99
R7704:Med13 UTSW 11 86,236,744 (GRCm39) nonsense probably null
R7922:Med13 UTSW 11 86,161,831 (GRCm39) missense probably damaging 0.98
R7943:Med13 UTSW 11 86,169,352 (GRCm39) missense probably damaging 0.97
R8062:Med13 UTSW 11 86,210,264 (GRCm39) missense probably benign
R8075:Med13 UTSW 11 86,163,296 (GRCm39) missense probably damaging 0.98
R8207:Med13 UTSW 11 86,194,375 (GRCm39) missense probably damaging 1.00
R8671:Med13 UTSW 11 86,161,923 (GRCm39) missense probably damaging 1.00
R9056:Med13 UTSW 11 86,189,660 (GRCm39) nonsense probably null
R9084:Med13 UTSW 11 86,191,621 (GRCm39) missense probably damaging 1.00
R9148:Med13 UTSW 11 86,192,297 (GRCm39) missense probably benign 0.27
R9329:Med13 UTSW 11 86,189,283 (GRCm39) missense probably benign 0.10
R9380:Med13 UTSW 11 86,177,598 (GRCm39) missense probably benign 0.42
R9515:Med13 UTSW 11 86,199,727 (GRCm39) missense probably benign 0.00
R9516:Med13 UTSW 11 86,179,801 (GRCm39) missense probably benign 0.01
R9690:Med13 UTSW 11 86,169,670 (GRCm39) missense probably damaging 1.00
R9751:Med13 UTSW 11 86,189,984 (GRCm39) missense probably damaging 1.00
R9752:Med13 UTSW 11 86,174,147 (GRCm39) missense possibly damaging 0.87
R9764:Med13 UTSW 11 86,177,345 (GRCm39) missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86,246,249 (GRCm39) missense probably damaging 1.00
Z1176:Med13 UTSW 11 86,236,688 (GRCm39) missense probably benign 0.45
Z1176:Med13 UTSW 11 86,219,370 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CATGCATCTGAGGAGTCTTTGCTACATC -3'
(R):5'- CTGCACATGGGCTTTATGAATTGTTCTG -3'

Sequencing Primer
(F):5'- CTGAGGAGTCTTTGCTACATCATTAG -3'
(R):5'- CAGCAACAGCAAGTACTTCC -3'
Posted On 2013-04-11