Mutagenetix > Incidental Mutation

Incidental Mutation 'R1852:Stxbp5'

208224

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

039876-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1852 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 9812298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 420 (V420F)

Ref Sequence

ENSEMBL: ENSMUSP00000044535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]

AlphaFold

Q8K400

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038213
AA Change: V420F

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: V420F

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125200
AA Change: V420F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: V420F

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141722
AA Change: V420F

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: V420F

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219200

Meta Mutation Damage Score

0.4019

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,268,473	D499G	probably damaging	Het
2900092C05Rik	A	G	7: 12,512,702		probably null	Het
4930433I11Rik	T	A	7: 40,993,613	D326E	probably benign	Het
A530032D15Rik	G	A	1: 85,085,131		probably benign	Het
Abca8a	T	C	11: 110,069,386	D676G	probably damaging	Het
Abcb7	T	C	X: 104,305,399	M153V	probably benign	Het
Ablim3	G	A	18: 61,849,395	H160Y	probably benign	Het
Acsl6	T	C	11: 54,361,076	I683T	probably damaging	Het
Adgrg5	A	T	8: 94,937,800	Y345F	probably damaging	Het
Alg6	T	G	4: 99,746,362	F114V	probably benign	Het
Ank2	A	C	3: 126,997,851		probably null	Het
Ankrd24	A	T	10: 81,642,941		probably benign	Het
Ano8	T	C	8: 71,483,487	K222E	probably damaging	Het
Arhgef5	T	C	6: 43,275,185	S957P	probably benign	Het
Bmpr1b	A	T	3: 141,857,402		probably null	Het
C3	A	G	17: 57,222,823	V2A	probably damaging	Het
Capn1	A	G	19: 6,009,103	V276A	possibly damaging	Het
Ccdc57	T	C	11: 120,921,673	E85G	probably damaging	Het
Chil3	C	T	3: 106,148,801		probably null	Het
Chl1	A	T	6: 103,699,159		probably null	Het
Chodl	C	T	16: 78,941,258	P38L	probably benign	Het
Clec4a2	G	T	6: 123,139,125	E124*	probably null	Het
Cmtr1	T	C	17: 29,702,255	V825A	probably benign	Het
Cnksr3	T	C	10: 7,120,539	I232V	probably benign	Het
Cntn1	C	T	15: 92,305,140	R768C	probably damaging	Het
Col15a1	G	T	4: 47,299,278		probably null	Het
Col6a3	T	A	1: 90,807,534	I798F	possibly damaging	Het
Cpxcr1	T	A	X: 116,478,061	L223*	probably null	Het
Cul1	A	G	6: 47,520,830	N615S	probably damaging	Het
Cxcr2	A	G	1: 74,159,279	I311V	probably benign	Het
Cyp2c67	C	T	19: 39,617,367	G362S	probably benign	Het
D930048N14Rik	T	A	11: 51,653,865		probably benign	Het
Ddx49	T	C	8: 70,300,983	T79A	probably damaging	Het
Defb46	T	A	8: 19,239,975		probably null	Het
Dnah17	T	A	11: 118,121,916	I145F	probably damaging	Het
Dock8	A	T	19: 25,127,128	I725F	probably benign	Het
Dppa4	G	A	16: 48,287,884	A11T	probably damaging	Het
Enam	T	A	5: 88,504,465	S1278T	possibly damaging	Het
Fndc3a	A	G	14: 72,556,843	V829A	probably damaging	Het
Gatb	T	G	3: 85,618,877	L354R	probably damaging	Het
Gm10787	A	T	10: 77,021,877		noncoding transcript	Het
Gm13084	T	C	4: 143,812,826	I32M	probably benign	Het
Gsap	T	A	5: 21,290,545		probably null	Het
Gtf2ird1	T	C	5: 134,382,580		probably null	Het
Has3	A	T	8: 106,874,079	I58F	probably damaging	Het
Haus5	A	T	7: 30,658,501		probably null	Het
Hip1r	T	C	5: 123,991,505	V169A	probably benign	Het
Hnf1a	T	A	5: 114,970,711	D45V	probably damaging	Het
Il20ra	T	A	10: 19,743,019	Y72N	probably damaging	Het
Ipo11	A	T	13: 106,812,257	V914E	possibly damaging	Het
Itpr1	T	C	6: 108,386,706	L763P	probably damaging	Het
Katnal2	C	A	18: 77,016,023	R104L	probably benign	Het
Kcng4	G	T	8: 119,626,208	P321Q	probably benign	Het
Larp4b	T	C	13: 9,137,303		probably null	Het
Lars	T	C	18: 42,212,608	N1001S	probably benign	Het
Lhcgr	T	A	17: 88,765,176	I148F	probably damaging	Het
Lsm10	T	A	4: 126,097,963	S37R	possibly damaging	Het
Mfsd13a	A	G	19: 46,372,180		probably null	Het
Mipep	T	A	14: 60,843,240	C560*	probably null	Het
Mme	A	G	3: 63,327,983	S97G	probably benign	Het
Mme	G	A	3: 63,328,046	D172N	probably benign	Het
Mx1	A	T	16: 97,448,203	L608Q	probably damaging	Het
Myt1l	T	C	12: 29,851,661	M208T	probably benign	Het
Neb	T	C	2: 52,228,542	I3987V	probably damaging	Het
Nelfcd	A	G	2: 174,423,978		probably null	Het
Neto1	T	C	18: 86,395,884	M1T	probably null	Het
Nom1	T	C	5: 29,446,878	F738S	possibly damaging	Het
Olfr1137	T	C	2: 87,710,973		probably null	Het
Olfr1160	T	G	2: 88,006,521	I86L	probably damaging	Het
Olfr1314	C	A	2: 112,091,847	V285L	probably benign	Het
Olfr1420	C	A	19: 11,896,885	P288H	probably damaging	Het
Olfr1487	C	T	19: 13,619,603	S147F	probably damaging	Het
Olfr523	T	A	7: 140,176,561	L147*	probably null	Het
Olfr572	C	T	7: 102,928,441	S271L	probably damaging	Het
Olfr772	T	C	10: 129,174,328	K231R	probably benign	Het
Pak1ip1	A	G	13: 41,011,232	T264A	possibly damaging	Het
Palb2	G	T	7: 122,114,314	D915E	possibly damaging	Het
Pank4	T	C	4: 154,976,359	L491P	probably damaging	Het
Paqr7	T	C	4: 134,507,669	V279A	probably benign	Het
Pcif1	G	A	2: 164,888,466	R373Q	probably damaging	Het
Pdgfa	T	A	5: 138,979,172	N185I	probably benign	Het
Plcd4	T	C	1: 74,549,361	V123A	possibly damaging	Het
Prune2	A	G	19: 17,199,139	I154V	probably damaging	Het
Rac3	T	G	11: 120,723,494	L148R	possibly damaging	Het
Rapgef6	T	A	11: 54,642,811	D362E	probably benign	Het
Rbl1	A	G	2: 157,174,903	I592T	probably benign	Het
Rbl2	A	C	8: 91,095,563	D408A	possibly damaging	Het
Retreg2	A	G	1: 75,146,675	K416E	probably benign	Het
Rorb	A	T	19: 18,962,083	L234H	probably damaging	Het
Rpp40	T	G	13: 35,896,914	D279A	probably benign	Het
Siglec1	C	A	2: 131,081,500	V442L	probably damaging	Het
Sik3	C	G	9: 46,221,089	H1276Q	probably benign	Het
Skiv2l2	A	T	13: 112,872,927	H979Q	probably benign	Het
Slc25a34	G	A	4: 141,622,268	T192I	probably benign	Het
Sptbn5	T	C	2: 120,071,644	I126M	possibly damaging	Het
Strada	A	G	11: 106,171,221	V94A	possibly damaging	Het
Tcrg-C3	A	T	13: 19,261,091	M70L	probably damaging	Het
Tgm1	T	C	14: 55,704,941	Y651C	probably damaging	Het
Tmem200c	T	A	17: 68,840,617	V65E	probably damaging	Het
Tmem74	A	T	15: 43,867,163	D161E	probably benign	Het
Vcan	T	G	13: 89,705,392	E483A	probably damaging	Het
Vmn2r124	A	G	17: 18,063,174	T377A	probably benign	Het
Vmn2r3	A	C	3: 64,259,394	I772S	probably damaging	Het
Wdfy3	A	G	5: 101,915,376	V1342A	probably benign	Het
Zfp507	T	C	7: 35,787,751	H764R	probably damaging	Het
Znrf3	A	G	11: 5,287,455	I218T	possibly damaging	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9866698	splice site	probably benign
R0631:Stxbp5	UTSW	10	9784358	missense	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4572:Stxbp5	UTSW	10	9838144	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4887:Stxbp5	UTSW	10	9809100	missense	probably benign
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6394:Stxbp5	UTSW	10	9899231	nonsense	probably null
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9798187	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8353:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9838115	nonsense	probably null
R9172:Stxbp5	UTSW	10	9769408	missense	possibly damaging	0.94
R9472:Stxbp5	UTSW	10	9843357	missense	probably damaging	1.00
R9513:Stxbp5	UTSW	10	9812010	missense	probably benign	0.17
R9649:Stxbp5	UTSW	10	9899194	missense	probably damaging	0.96
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GTAACTTTGAGCACCCAAGC -3'
(R):5'- AAACGCTTCACTGTTTTCACAC -3'

Sequencing Primer
(F):5'- GGTCTATTAGGAAGTTATGAACACAG -3'
(R):5'- ACGCTTCACTGTTTTCACACATTTAC -3'

Posted On

2014-06-23