Mutagenetix > Incidental Mutation

Incidental Mutation 'R1852:Rapgef6'

208235

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

MMRRC Submission

039876-MU

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1852 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 54642811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 362 (D362E)

Ref Sequence

ENSEMBL: ENSMUSP00000104522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429] [ENSMUST00000218995]

AlphaFold

Q5NCJ1

Predicted Effect

probably benign
Transcript: ENSMUST00000094536
AA Change: D362E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: D362E

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101206
AA Change: D647E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: D647E

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102743
AA Change: D647E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: D647E

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108894
AA Change: D362E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: D362E

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149372

Predicted Effect

probably benign
Transcript: ENSMUST00000207429
AA Change: D647E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000218995
AA Change: D500E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220269

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,268,473	D499G	probably damaging	Het
2900092C05Rik	A	G	7: 12,512,702		probably null	Het
4930433I11Rik	T	A	7: 40,993,613	D326E	probably benign	Het
A530032D15Rik	G	A	1: 85,085,131		probably benign	Het
Abca8a	T	C	11: 110,069,386	D676G	probably damaging	Het
Abcb7	T	C	X: 104,305,399	M153V	probably benign	Het
Ablim3	G	A	18: 61,849,395	H160Y	probably benign	Het
Acsl6	T	C	11: 54,361,076	I683T	probably damaging	Het
Adgrg5	A	T	8: 94,937,800	Y345F	probably damaging	Het
Alg6	T	G	4: 99,746,362	F114V	probably benign	Het
Ank2	A	C	3: 126,997,851		probably null	Het
Ankrd24	A	T	10: 81,642,941		probably benign	Het
Ano8	T	C	8: 71,483,487	K222E	probably damaging	Het
Arhgef5	T	C	6: 43,275,185	S957P	probably benign	Het
Bmpr1b	A	T	3: 141,857,402		probably null	Het
C3	A	G	17: 57,222,823	V2A	probably damaging	Het
Capn1	A	G	19: 6,009,103	V276A	possibly damaging	Het
Ccdc57	T	C	11: 120,921,673	E85G	probably damaging	Het
Chil3	C	T	3: 106,148,801		probably null	Het
Chl1	A	T	6: 103,699,159		probably null	Het
Chodl	C	T	16: 78,941,258	P38L	probably benign	Het
Clec4a2	G	T	6: 123,139,125	E124*	probably null	Het
Cmtr1	T	C	17: 29,702,255	V825A	probably benign	Het
Cnksr3	T	C	10: 7,120,539	I232V	probably benign	Het
Cntn1	C	T	15: 92,305,140	R768C	probably damaging	Het
Col15a1	G	T	4: 47,299,278		probably null	Het
Col6a3	T	A	1: 90,807,534	I798F	possibly damaging	Het
Cpxcr1	T	A	X: 116,478,061	L223*	probably null	Het
Cul1	A	G	6: 47,520,830	N615S	probably damaging	Het
Cxcr2	A	G	1: 74,159,279	I311V	probably benign	Het
Cyp2c67	C	T	19: 39,617,367	G362S	probably benign	Het
D930048N14Rik	T	A	11: 51,653,865		probably benign	Het
Ddx49	T	C	8: 70,300,983	T79A	probably damaging	Het
Defb46	T	A	8: 19,239,975		probably null	Het
Dnah17	T	A	11: 118,121,916	I145F	probably damaging	Het
Dock8	A	T	19: 25,127,128	I725F	probably benign	Het
Dppa4	G	A	16: 48,287,884	A11T	probably damaging	Het
Enam	T	A	5: 88,504,465	S1278T	possibly damaging	Het
Fndc3a	A	G	14: 72,556,843	V829A	probably damaging	Het
Gatb	T	G	3: 85,618,877	L354R	probably damaging	Het
Gm10787	A	T	10: 77,021,877		noncoding transcript	Het
Gm13084	T	C	4: 143,812,826	I32M	probably benign	Het
Gsap	T	A	5: 21,290,545		probably null	Het
Gtf2ird1	T	C	5: 134,382,580		probably null	Het
Has3	A	T	8: 106,874,079	I58F	probably damaging	Het
Haus5	A	T	7: 30,658,501		probably null	Het
Hip1r	T	C	5: 123,991,505	V169A	probably benign	Het
Hnf1a	T	A	5: 114,970,711	D45V	probably damaging	Het
Il20ra	T	A	10: 19,743,019	Y72N	probably damaging	Het
Ipo11	A	T	13: 106,812,257	V914E	possibly damaging	Het
Itpr1	T	C	6: 108,386,706	L763P	probably damaging	Het
Katnal2	C	A	18: 77,016,023	R104L	probably benign	Het
Kcng4	G	T	8: 119,626,208	P321Q	probably benign	Het
Larp4b	T	C	13: 9,137,303		probably null	Het
Lars	T	C	18: 42,212,608	N1001S	probably benign	Het
Lhcgr	T	A	17: 88,765,176	I148F	probably damaging	Het
Lsm10	T	A	4: 126,097,963	S37R	possibly damaging	Het
Mfsd13a	A	G	19: 46,372,180		probably null	Het
Mipep	T	A	14: 60,843,240	C560*	probably null	Het
Mme	A	G	3: 63,327,983	S97G	probably benign	Het
Mme	G	A	3: 63,328,046	D172N	probably benign	Het
Mx1	A	T	16: 97,448,203	L608Q	probably damaging	Het
Myt1l	T	C	12: 29,851,661	M208T	probably benign	Het
Neb	T	C	2: 52,228,542	I3987V	probably damaging	Het
Nelfcd	A	G	2: 174,423,978		probably null	Het
Neto1	T	C	18: 86,395,884	M1T	probably null	Het
Nom1	T	C	5: 29,446,878	F738S	possibly damaging	Het
Olfr1137	T	C	2: 87,710,973		probably null	Het
Olfr1160	T	G	2: 88,006,521	I86L	probably damaging	Het
Olfr1314	C	A	2: 112,091,847	V285L	probably benign	Het
Olfr1420	C	A	19: 11,896,885	P288H	probably damaging	Het
Olfr1487	C	T	19: 13,619,603	S147F	probably damaging	Het
Olfr523	T	A	7: 140,176,561	L147*	probably null	Het
Olfr572	C	T	7: 102,928,441	S271L	probably damaging	Het
Olfr772	T	C	10: 129,174,328	K231R	probably benign	Het
Pak1ip1	A	G	13: 41,011,232	T264A	possibly damaging	Het
Palb2	G	T	7: 122,114,314	D915E	possibly damaging	Het
Pank4	T	C	4: 154,976,359	L491P	probably damaging	Het
Paqr7	T	C	4: 134,507,669	V279A	probably benign	Het
Pcif1	G	A	2: 164,888,466	R373Q	probably damaging	Het
Pdgfa	T	A	5: 138,979,172	N185I	probably benign	Het
Plcd4	T	C	1: 74,549,361	V123A	possibly damaging	Het
Prune2	A	G	19: 17,199,139	I154V	probably damaging	Het
Rac3	T	G	11: 120,723,494	L148R	possibly damaging	Het
Rbl1	A	G	2: 157,174,903	I592T	probably benign	Het
Rbl2	A	C	8: 91,095,563	D408A	possibly damaging	Het
Retreg2	A	G	1: 75,146,675	K416E	probably benign	Het
Rorb	A	T	19: 18,962,083	L234H	probably damaging	Het
Rpp40	T	G	13: 35,896,914	D279A	probably benign	Het
Siglec1	C	A	2: 131,081,500	V442L	probably damaging	Het
Sik3	C	G	9: 46,221,089	H1276Q	probably benign	Het
Skiv2l2	A	T	13: 112,872,927	H979Q	probably benign	Het
Slc25a34	G	A	4: 141,622,268	T192I	probably benign	Het
Sptbn5	T	C	2: 120,071,644	I126M	possibly damaging	Het
Strada	A	G	11: 106,171,221	V94A	possibly damaging	Het
Stxbp5	C	A	10: 9,812,298	V420F	possibly damaging	Het
Tcrg-C3	A	T	13: 19,261,091	M70L	probably damaging	Het
Tgm1	T	C	14: 55,704,941	Y651C	probably damaging	Het
Tmem200c	T	A	17: 68,840,617	V65E	probably damaging	Het
Tmem74	A	T	15: 43,867,163	D161E	probably benign	Het
Vcan	T	G	13: 89,705,392	E483A	probably damaging	Het
Vmn2r124	A	G	17: 18,063,174	T377A	probably benign	Het
Vmn2r3	A	C	3: 64,259,394	I772S	probably damaging	Het
Wdfy3	A	G	5: 101,915,376	V1342A	probably benign	Het
Zfp507	T	C	7: 35,787,751	H764R	probably damaging	Het
Znrf3	A	G	11: 5,287,455	I218T	possibly damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09
R9031:Rapgef6	UTSW	11	54687841	missense	probably benign	0.00
R9093:Rapgef6	UTSW	11	54597086	nonsense	probably null
R9354:Rapgef6	UTSW	11	54619923	missense	possibly damaging	0.66
R9514:Rapgef6	UTSW	11	54552858	missense	probably benign	0.14
R9516:Rapgef6	UTSW	11	54691343	missense	probably damaging	1.00
R9739:Rapgef6	UTSW	11	54622363	missense	probably benign	0.03
R9789:Rapgef6	UTSW	11	54649271	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACTTTGGGGATCGAGCAGATG -3'
(R):5'- GACTCAGCTCTCTTTCCTACAATAAAC -3'

Sequencing Primer
(F):5'- ATTTCTGAGTTCCAGGACAGCCAG -3'
(R):5'- CAATAAACATTAAAATCCCCACATGG -3'

Posted On

2014-06-23