Incidental Mutation 'R0116:Dnah17'
ID20826
Institutional Source Beutler Lab
Gene Symbol Dnah17
Ensembl Gene ENSMUSG00000033987
Gene Namedynein, axonemal, heavy chain 17
SynonymsLOC382552, Dnahcl1, 2810003K23Rik, Dnahc17
MMRRC Submission 038402-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0116 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location118021723-118130634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118058306 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2959 (E2959G)
Ref Sequence ENSEMBL: ENSMUSP00000081864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]
Predicted Effect probably benign
Transcript: ENSMUST00000084803
AA Change: E2959G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: E2959G

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106308
AA Change: E2959G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: E2959G

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132685
AA Change: E2972G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: E2972G

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 94% (95/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,290,770 V152E probably damaging Het
Abca5 T G 11: 110,276,505 E1495A probably damaging Het
Abcc12 G A 8: 86,534,998 S668F probably benign Het
Adgrl4 A T 3: 151,517,610 T608S probably benign Het
Angel2 G A 1: 190,940,990 D255N probably benign Het
Apob T A 12: 7,989,113 probably benign Het
Arfgef2 A T 2: 166,873,683 R1349S probably damaging Het
Atp2b2 C T 6: 113,793,695 V418I probably damaging Het
Birc6 C A 17: 74,623,746 probably benign Het
Capn13 T A 17: 73,351,524 Y183F probably damaging Het
Cngb1 A G 8: 95,260,638 S352P probably damaging Het
Col6a3 A G 1: 90,813,551 S720P probably damaging Het
Cpa4 C T 6: 30,579,658 R155W probably damaging Het
Dapk1 A G 13: 60,761,100 I1176V probably benign Het
Dnah7b T A 1: 46,213,360 I1734N possibly damaging Het
Dnajb7 A G 15: 81,407,354 Y261H probably benign Het
Dock2 T C 11: 34,688,565 probably benign Het
Dusp27 A C 1: 166,099,701 S781A probably benign Het
Dyrk3 A T 1: 131,129,839 V199E probably damaging Het
F2r G T 13: 95,604,486 C180* probably null Het
F5 A G 1: 164,184,914 S466G probably benign Het
Fbn2 A T 18: 58,102,373 C677* probably null Het
Fbxo41 A G 6: 85,477,908 S673P probably damaging Het
Fhad1 G T 4: 141,940,095 H639N probably benign Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Foxa2 A G 2: 148,043,561 S270P probably damaging Het
Fxyd7 C T 7: 31,047,368 probably null Het
Gm5225 A G 17: 24,024,058 D67G probably benign Het
Grik3 G A 4: 125,670,556 E444K probably benign Het
Gsdma2 A G 11: 98,649,183 K44E probably damaging Het
Haus1 T A 18: 77,762,070 K130* probably null Het
Heg1 A G 16: 33,735,658 probably benign Het
Hormad2 A G 11: 4,412,206 probably benign Het
Hsd17b3 G A 13: 64,058,589 R300C possibly damaging Het
Irf5 T C 6: 29,536,109 F374S probably damaging Het
Itch A G 2: 155,217,983 probably benign Het
Jade2 A T 11: 51,831,309 L139Q probably damaging Het
Kif5c G A 2: 49,752,239 probably benign Het
Lama1 T C 17: 67,776,923 Y1387H probably benign Het
Larp4b A G 13: 9,170,688 R658G probably damaging Het
Mcph1 C T 8: 18,788,248 L729F probably benign Het
Me1 A T 9: 86,654,667 N118K probably benign Het
Med13 A G 11: 86,319,897 L473S probably damaging Het
Mgam T A 6: 40,658,987 Y359N probably damaging Het
Morc2b A G 17: 33,137,041 S586P probably damaging Het
Mthfr A G 4: 148,051,523 D310G probably benign Het
Mtmr7 A T 8: 40,581,405 probably benign Het
Mtus1 A G 8: 40,998,477 probably benign Het
Mus81 G T 19: 5,486,524 A138D probably damaging Het
Myom2 A T 8: 15,117,633 I1073F probably damaging Het
Nhsl1 A T 10: 18,525,242 K739* probably null Het
Nlrp4d T A 7: 10,374,891 K762N probably benign Het
Nrap T C 19: 56,355,546 Y724C probably damaging Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr805 T A 10: 129,722,977 D189V probably damaging Het
Olfr923 T C 9: 38,828,564 L291P probably damaging Het
Olfr948 A T 9: 39,318,864 I250N probably damaging Het
Padi2 T C 4: 140,926,239 V180A probably benign Het
Papss2 C T 19: 32,638,368 R167* probably null Het
Pcbp2 T C 15: 102,474,235 probably benign Het
Per1 T A 11: 69,101,880 probably benign Het
Pik3ca T C 3: 32,459,945 I860T probably damaging Het
Pkdrej G A 15: 85,817,545 Q1397* probably null Het
Plce1 T C 19: 38,721,821 V1133A probably benign Het
Pnmal1 T G 7: 16,960,700 V160G probably damaging Het
Prss12 T C 3: 123,482,774 C351R probably damaging Het
Qprt A T 7: 127,109,097 L54Q probably damaging Het
Raf1 C T 6: 115,626,383 S165N probably damaging Het
Rere A G 4: 150,616,976 N1271S probably benign Het
Rnasel T A 1: 153,754,512 L258H probably damaging Het
Ryr2 T C 13: 11,709,921 D2502G probably damaging Het
Ryr3 G A 2: 112,803,165 S2081L probably damaging Het
Sc5d G T 9: 42,259,859 Y11* probably null Het
Slc25a29 A C 12: 108,827,091 L187R possibly damaging Het
Slc2a7 G A 4: 150,168,264 V454M probably benign Het
Slco1b2 A T 6: 141,669,388 T340S probably benign Het
Smarcc1 A G 9: 110,147,104 N153S possibly damaging Het
Snx1 C A 9: 66,088,539 E516* probably null Het
Sptlc2 T C 12: 87,356,680 D115G probably benign Het
Stard9 A G 2: 120,634,255 N67S probably damaging Het
Swap70 G A 7: 110,273,282 R368H probably benign Het
Tcaf3 T C 6: 42,591,350 K691E probably benign Het
Tmco4 T C 4: 139,053,920 F465S probably damaging Het
Tmem245 A G 4: 56,926,213 S290P probably benign Het
Top2a T C 11: 99,003,590 T972A probably benign Het
Tpr T A 1: 150,410,147 S527R probably damaging Het
Traf2 T C 2: 25,519,609 D443G probably damaging Het
Trim40 A T 17: 36,883,147 probably null Het
Trim42 A T 9: 97,363,403 I448N possibly damaging Het
Ttll9 G A 2: 152,983,134 V78M probably damaging Het
Vav1 C T 17: 57,296,039 L88F probably damaging Het
Vps13b A G 15: 35,423,155 D207G probably damaging Het
Wdsub1 A G 2: 59,876,665 probably null Het
Zfp799 A G 17: 32,821,035 W85R possibly damaging Het
Zfp839 A T 12: 110,858,769 probably benign Het
Other mutations in Dnah17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Dnah17 APN 11 118088214 missense possibly damaging 0.81
IGL00531:Dnah17 APN 11 118043173 missense probably damaging 0.97
IGL00764:Dnah17 APN 11 118096485 missense probably damaging 0.99
IGL00795:Dnah17 APN 11 118093634 missense probably benign 0.35
IGL00823:Dnah17 APN 11 118047161 missense probably benign 0.22
IGL01145:Dnah17 APN 11 118047173 missense possibly damaging 0.63
IGL01433:Dnah17 APN 11 118049934 missense probably damaging 1.00
IGL01454:Dnah17 APN 11 118058397 missense probably damaging 1.00
IGL01545:Dnah17 APN 11 118119568 missense probably damaging 1.00
IGL01548:Dnah17 APN 11 118098612 missense probably benign 0.21
IGL01557:Dnah17 APN 11 118073686 missense probably damaging 0.98
IGL01632:Dnah17 APN 11 118033881 missense probably damaging 1.00
IGL01636:Dnah17 APN 11 118041056 missense probably benign 0.03
IGL01672:Dnah17 APN 11 118042160 missense probably damaging 0.97
IGL01822:Dnah17 APN 11 118081993 missense probably damaging 1.00
IGL01869:Dnah17 APN 11 118052676 missense probably benign 0.09
IGL01916:Dnah17 APN 11 118125288 missense probably benign 0.00
IGL02131:Dnah17 APN 11 118072908 missense probably damaging 1.00
IGL02154:Dnah17 APN 11 118124261 missense probably benign 0.01
IGL02220:Dnah17 APN 11 118072967 nonsense probably null
IGL02454:Dnah17 APN 11 118080767 missense probably damaging 0.98
IGL02458:Dnah17 APN 11 118036350 missense probably damaging 1.00
IGL02588:Dnah17 APN 11 118025653 missense possibly damaging 0.95
IGL02865:Dnah17 APN 11 118073548 missense probably damaging 1.00
IGL02881:Dnah17 APN 11 118042118 missense probably damaging 1.00
IGL02952:Dnah17 APN 11 118088268 missense probably benign 0.03
IGL03382:Dnah17 APN 11 118081943 missense probably damaging 1.00
IGL03389:Dnah17 APN 11 118094979 missense probably damaging 1.00
ergos UTSW 11 118041158 splice site probably benign
watt UTSW 11 118080766 missense probably damaging 0.96
PIT4280001:Dnah17 UTSW 11 118098582 missense possibly damaging 0.85
R0004:Dnah17 UTSW 11 118060092 missense possibly damaging 0.90
R0112:Dnah17 UTSW 11 118074434 missense possibly damaging 0.82
R0157:Dnah17 UTSW 11 118127171 missense probably benign
R0320:Dnah17 UTSW 11 118052674 missense possibly damaging 0.56
R0362:Dnah17 UTSW 11 118098539 missense probably benign 0.10
R0382:Dnah17 UTSW 11 118128996 missense probably damaging 1.00
R0383:Dnah17 UTSW 11 118067547 missense probably benign
R0400:Dnah17 UTSW 11 118082078 missense probably damaging 1.00
R0420:Dnah17 UTSW 11 118039939 missense probably damaging 1.00
R0483:Dnah17 UTSW 11 118047124 missense probably benign
R0533:Dnah17 UTSW 11 118110537 missense possibly damaging 0.50
R0562:Dnah17 UTSW 11 118072900 missense probably damaging 1.00
R0564:Dnah17 UTSW 11 118082981 missense probably damaging 1.00
R0604:Dnah17 UTSW 11 118121471 missense probably benign 0.00
R0608:Dnah17 UTSW 11 118090749 nonsense probably null
R0614:Dnah17 UTSW 11 118070568 splice site probably benign
R0632:Dnah17 UTSW 11 118067682 splice site probably benign
R0831:Dnah17 UTSW 11 118060271 missense probably damaging 0.99
R0838:Dnah17 UTSW 11 118060104 missense probably damaging 1.00
R0879:Dnah17 UTSW 11 118056835 splice site probably benign
R1061:Dnah17 UTSW 11 118052688 missense possibly damaging 0.51
R1190:Dnah17 UTSW 11 118042175 missense probably damaging 1.00
R1293:Dnah17 UTSW 11 118127137 critical splice donor site probably null
R1297:Dnah17 UTSW 11 118121366 splice site probably benign
R1332:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1336:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1364:Dnah17 UTSW 11 118125606 splice site probably benign
R1418:Dnah17 UTSW 11 118074023 missense probably damaging 0.98
R1432:Dnah17 UTSW 11 118023327 missense probably damaging 1.00
R1497:Dnah17 UTSW 11 118114233 missense probably damaging 1.00
R1500:Dnah17 UTSW 11 118101053 missense probably benign
R1506:Dnah17 UTSW 11 118125387 missense possibly damaging 0.53
R1512:Dnah17 UTSW 11 118095015 missense probably benign
R1567:Dnah17 UTSW 11 118125985 missense probably damaging 1.00
R1597:Dnah17 UTSW 11 118103498 splice site probably benign
R1665:Dnah17 UTSW 11 118121495 splice site probably benign
R1703:Dnah17 UTSW 11 118026749 missense probably damaging 1.00
R1716:Dnah17 UTSW 11 118032598 missense probably benign 0.00
R1727:Dnah17 UTSW 11 118070489 missense probably damaging 0.98
R1727:Dnah17 UTSW 11 118096536 nonsense probably null
R1728:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1784:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1852:Dnah17 UTSW 11 118121916 missense probably damaging 0.97
R1869:Dnah17 UTSW 11 118047189 nonsense probably null
R1886:Dnah17 UTSW 11 118108161 missense possibly damaging 0.62
R1893:Dnah17 UTSW 11 118066968 missense probably benign 0.00
R1954:Dnah17 UTSW 11 118024731 missense probably damaging 1.00
R1969:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1971:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1975:Dnah17 UTSW 11 118096536 nonsense probably null
R1977:Dnah17 UTSW 11 118112591 missense possibly damaging 0.52
R2055:Dnah17 UTSW 11 118067531 missense probably benign 0.00
R2115:Dnah17 UTSW 11 118119802 missense probably benign 0.00
R2132:Dnah17 UTSW 11 118033747 missense probably damaging 0.98
R2200:Dnah17 UTSW 11 118102409 splice site probably benign
R2277:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2279:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2400:Dnah17 UTSW 11 118126384 critical splice acceptor site probably null
R2402:Dnah17 UTSW 11 118125974 missense probably benign 0.10
R2497:Dnah17 UTSW 11 118087024 synonymous probably null
R2923:Dnah17 UTSW 11 118093547 missense probably damaging 1.00
R3121:Dnah17 UTSW 11 118041086 missense probably damaging 1.00
R3236:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3237:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3498:Dnah17 UTSW 11 118080849 splice site probably benign
R3499:Dnah17 UTSW 11 118080849 splice site probably benign
R3746:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3749:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3762:Dnah17 UTSW 11 118104526 missense probably benign 0.00
R3826:Dnah17 UTSW 11 118041158 splice site probably benign
R3828:Dnah17 UTSW 11 118041158 splice site probably benign
R3829:Dnah17 UTSW 11 118041158 splice site probably benign
R3877:Dnah17 UTSW 11 118024707 missense probably damaging 1.00
R3899:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3900:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3911:Dnah17 UTSW 11 118080849 splice site probably benign
R3913:Dnah17 UTSW 11 118080849 splice site probably benign
R3930:Dnah17 UTSW 11 118080849 splice site probably benign
R3931:Dnah17 UTSW 11 118080849 splice site probably benign
R3969:Dnah17 UTSW 11 118041158 splice site probably benign
R3970:Dnah17 UTSW 11 118041158 splice site probably benign
R4056:Dnah17 UTSW 11 118070538 missense probably benign 0.05
R4113:Dnah17 UTSW 11 118112594 missense possibly damaging 0.50
R4295:Dnah17 UTSW 11 118118772 missense probably damaging 1.00
R4324:Dnah17 UTSW 11 118094213 missense probably benign 0.01
R4412:Dnah17 UTSW 11 118073683 missense probably damaging 1.00
R4413:Dnah17 UTSW 11 118025168 missense probably benign 0.00
R4422:Dnah17 UTSW 11 118081973 missense possibly damaging 0.91
R4552:Dnah17 UTSW 11 118052943 missense possibly damaging 0.79
R4669:Dnah17 UTSW 11 118074293 missense probably benign 0.02
R4677:Dnah17 UTSW 11 118119814 missense probably damaging 1.00
R4716:Dnah17 UTSW 11 118073648 missense probably benign 0.02
R4832:Dnah17 UTSW 11 118026780 missense probably damaging 1.00
R4868:Dnah17 UTSW 11 118108212 missense probably benign 0.03
R4897:Dnah17 UTSW 11 118078593 missense probably damaging 1.00
R4928:Dnah17 UTSW 11 118027433 missense probably damaging 1.00
R4937:Dnah17 UTSW 11 118042154 missense probably damaging 1.00
R4957:Dnah17 UTSW 11 118074298 missense probably benign 0.44
R5008:Dnah17 UTSW 11 118110577 missense probably benign 0.01
R5016:Dnah17 UTSW 11 118080766 missense probably damaging 0.96
R5027:Dnah17 UTSW 11 118102539 missense probably benign 0.01
R5133:Dnah17 UTSW 11 118117113 missense probably benign 0.00
R5140:Dnah17 UTSW 11 118086945 missense probably damaging 1.00
R5146:Dnah17 UTSW 11 118114179 missense probably damaging 0.99
R5151:Dnah17 UTSW 11 118027467 missense probably damaging 1.00
R5153:Dnah17 UTSW 11 118082974 nonsense probably null
R5192:Dnah17 UTSW 11 118034359 missense possibly damaging 0.96
R5315:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5317:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5335:Dnah17 UTSW 11 118112514 missense probably damaging 1.00
R5379:Dnah17 UTSW 11 118117203 intron probably benign
R5396:Dnah17 UTSW 11 118127282 missense probably benign
R5418:Dnah17 UTSW 11 118094984 missense probably benign 0.04
R5534:Dnah17 UTSW 11 118052770 missense possibly damaging 0.83
R5539:Dnah17 UTSW 11 118073660 missense probably benign 0.03
R5594:Dnah17 UTSW 11 118043229 splice site probably null
R5634:Dnah17 UTSW 11 118052926 splice site probably null
R5696:Dnah17 UTSW 11 118101056 missense probably benign 0.44
R5802:Dnah17 UTSW 11 118036446 missense possibly damaging 0.79
R5826:Dnah17 UTSW 11 118034367 missense probably damaging 1.00
R5873:Dnah17 UTSW 11 118056897 missense probably benign 0.01
R5898:Dnah17 UTSW 11 118114213 missense probably benign 0.00
R5934:Dnah17 UTSW 11 118041102 missense probably benign
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6113:Dnah17 UTSW 11 118126275 missense probably damaging 1.00
R6117:Dnah17 UTSW 11 118119571 missense probably benign 0.00
R6137:Dnah17 UTSW 11 118025654 missense probably damaging 1.00
R6173:Dnah17 UTSW 11 118039946 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126323 nonsense probably null
R6258:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126323 nonsense probably null
R6260:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6278:Dnah17 UTSW 11 118126290 missense probably damaging 0.99
R6298:Dnah17 UTSW 11 118108161 missense probably benign 0.00
R6300:Dnah17 UTSW 11 118034310 missense probably damaging 1.00
R6302:Dnah17 UTSW 11 118129155 missense probably benign 0.09
R6363:Dnah17 UTSW 11 118110505 missense probably benign
R6381:Dnah17 UTSW 11 118129185 missense probably benign 0.08
R6418:Dnah17 UTSW 11 118129197 missense probably damaging 0.99
R6660:Dnah17 UTSW 11 118100188 missense probably benign
R6803:Dnah17 UTSW 11 118125372 missense probably benign 0.00
R6820:Dnah17 UTSW 11 118069000 missense probably damaging 0.99
R6885:Dnah17 UTSW 11 118090772 missense possibly damaging 0.47
R6921:Dnah17 UTSW 11 118041484 missense probably damaging 0.98
R6932:Dnah17 UTSW 11 118060079 missense possibly damaging 0.95
R6954:Dnah17 UTSW 11 118066432 missense probably damaging 1.00
R7000:Dnah17 UTSW 11 118025702 critical splice acceptor site probably null
R7007:Dnah17 UTSW 11 118118871 missense possibly damaging 0.92
R7048:Dnah17 UTSW 11 118046118 missense possibly damaging 0.80
R7056:Dnah17 UTSW 11 118125386 missense probably benign
R7131:Dnah17 UTSW 11 118079658 missense probably benign 0.14
R7143:Dnah17 UTSW 11 118086130 missense probably damaging 1.00
R7146:Dnah17 UTSW 11 118082110 missense probably damaging 0.98
R7147:Dnah17 UTSW 11 118094929 missense probably benign 0.31
R7172:Dnah17 UTSW 11 118041131 nonsense probably null
R7183:Dnah17 UTSW 11 118129188 missense probably benign
R7297:Dnah17 UTSW 11 118055730 critical splice donor site probably null
R7297:Dnah17 UTSW 11 118103356 missense probably damaging 0.98
R7367:Dnah17 UTSW 11 118115196 missense probably benign
R7398:Dnah17 UTSW 11 118080724 missense probably damaging 0.96
R7426:Dnah17 UTSW 11 118090717 missense probably null 0.79
R7524:Dnah17 UTSW 11 118121481 missense probably benign 0.03
R7529:Dnah17 UTSW 11 118049866 critical splice donor site probably null
R7615:Dnah17 UTSW 11 118110547 nonsense probably null
R7681:Dnah17 UTSW 11 118025186 missense probably damaging 1.00
R7702:Dnah17 UTSW 11 118025640 missense probably benign 0.00
R7702:Dnah17 UTSW 11 118121478 missense possibly damaging 0.64
R7713:Dnah17 UTSW 11 118025171 missense probably benign 0.02
X0058:Dnah17 UTSW 11 118082925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCACCCCGTTTCAATCTCCG -3'
(R):5'- GTCTATGAGAAGCAATGTCCCCACC -3'

Sequencing Primer
(F):5'- AATCTCCGTTGGTTTGCTACTG -3'
(R):5'- TAGAACTGTGGAGCTGTACCC -3'
Posted On2013-04-11