Incidental Mutation 'R0116:Apob'
ID20827
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Nameapolipoprotein B
Synonymsapob-100, apob-48
MMRRC Submission 038402-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R0116 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location7977648-8016835 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 7989113 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171271]
Predicted Effect probably benign
Transcript: ENSMUST00000037520
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037811
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171271
SMART Domains Protein: ENSMUSP00000127147
Gene: ENSMUSG00000020609

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Vitellogenin_N 45 324 6.7e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 94% (95/101)
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,290,770 V152E probably damaging Het
Abca5 T G 11: 110,276,505 E1495A probably damaging Het
Abcc12 G A 8: 86,534,998 S668F probably benign Het
Adgrl4 A T 3: 151,517,610 T608S probably benign Het
Angel2 G A 1: 190,940,990 D255N probably benign Het
Arfgef2 A T 2: 166,873,683 R1349S probably damaging Het
Atp2b2 C T 6: 113,793,695 V418I probably damaging Het
Birc6 C A 17: 74,623,746 probably benign Het
Capn13 T A 17: 73,351,524 Y183F probably damaging Het
Cngb1 A G 8: 95,260,638 S352P probably damaging Het
Col6a3 A G 1: 90,813,551 S720P probably damaging Het
Cpa4 C T 6: 30,579,658 R155W probably damaging Het
Dapk1 A G 13: 60,761,100 I1176V probably benign Het
Dnah17 T C 11: 118,058,306 E2959G probably benign Het
Dnah7b T A 1: 46,213,360 I1734N possibly damaging Het
Dnajb7 A G 15: 81,407,354 Y261H probably benign Het
Dock2 T C 11: 34,688,565 probably benign Het
Dusp27 A C 1: 166,099,701 S781A probably benign Het
Dyrk3 A T 1: 131,129,839 V199E probably damaging Het
F2r G T 13: 95,604,486 C180* probably null Het
F5 A G 1: 164,184,914 S466G probably benign Het
Fbn2 A T 18: 58,102,373 C677* probably null Het
Fbxo41 A G 6: 85,477,908 S673P probably damaging Het
Fhad1 G T 4: 141,940,095 H639N probably benign Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Foxa2 A G 2: 148,043,561 S270P probably damaging Het
Fxyd7 C T 7: 31,047,368 probably null Het
Gm5225 A G 17: 24,024,058 D67G probably benign Het
Grik3 G A 4: 125,670,556 E444K probably benign Het
Gsdma2 A G 11: 98,649,183 K44E probably damaging Het
Haus1 T A 18: 77,762,070 K130* probably null Het
Heg1 A G 16: 33,735,658 probably benign Het
Hormad2 A G 11: 4,412,206 probably benign Het
Hsd17b3 G A 13: 64,058,589 R300C possibly damaging Het
Irf5 T C 6: 29,536,109 F374S probably damaging Het
Itch A G 2: 155,217,983 probably benign Het
Jade2 A T 11: 51,831,309 L139Q probably damaging Het
Kif5c G A 2: 49,752,239 probably benign Het
Lama1 T C 17: 67,776,923 Y1387H probably benign Het
Larp4b A G 13: 9,170,688 R658G probably damaging Het
Mcph1 C T 8: 18,788,248 L729F probably benign Het
Me1 A T 9: 86,654,667 N118K probably benign Het
Med13 A G 11: 86,319,897 L473S probably damaging Het
Mgam T A 6: 40,658,987 Y359N probably damaging Het
Morc2b A G 17: 33,137,041 S586P probably damaging Het
Mthfr A G 4: 148,051,523 D310G probably benign Het
Mtmr7 A T 8: 40,581,405 probably benign Het
Mtus1 A G 8: 40,998,477 probably benign Het
Mus81 G T 19: 5,486,524 A138D probably damaging Het
Myom2 A T 8: 15,117,633 I1073F probably damaging Het
Nhsl1 A T 10: 18,525,242 K739* probably null Het
Nlrp4d T A 7: 10,374,891 K762N probably benign Het
Nrap T C 19: 56,355,546 Y724C probably damaging Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr805 T A 10: 129,722,977 D189V probably damaging Het
Olfr923 T C 9: 38,828,564 L291P probably damaging Het
Olfr948 A T 9: 39,318,864 I250N probably damaging Het
Padi2 T C 4: 140,926,239 V180A probably benign Het
Papss2 C T 19: 32,638,368 R167* probably null Het
Pcbp2 T C 15: 102,474,235 probably benign Het
Per1 T A 11: 69,101,880 probably benign Het
Pik3ca T C 3: 32,459,945 I860T probably damaging Het
Pkdrej G A 15: 85,817,545 Q1397* probably null Het
Plce1 T C 19: 38,721,821 V1133A probably benign Het
Pnmal1 T G 7: 16,960,700 V160G probably damaging Het
Prss12 T C 3: 123,482,774 C351R probably damaging Het
Qprt A T 7: 127,109,097 L54Q probably damaging Het
Raf1 C T 6: 115,626,383 S165N probably damaging Het
Rere A G 4: 150,616,976 N1271S probably benign Het
Rnasel T A 1: 153,754,512 L258H probably damaging Het
Ryr2 T C 13: 11,709,921 D2502G probably damaging Het
Ryr3 G A 2: 112,803,165 S2081L probably damaging Het
Sc5d G T 9: 42,259,859 Y11* probably null Het
Slc25a29 A C 12: 108,827,091 L187R possibly damaging Het
Slc2a7 G A 4: 150,168,264 V454M probably benign Het
Slco1b2 A T 6: 141,669,388 T340S probably benign Het
Smarcc1 A G 9: 110,147,104 N153S possibly damaging Het
Snx1 C A 9: 66,088,539 E516* probably null Het
Sptlc2 T C 12: 87,356,680 D115G probably benign Het
Stard9 A G 2: 120,634,255 N67S probably damaging Het
Swap70 G A 7: 110,273,282 R368H probably benign Het
Tcaf3 T C 6: 42,591,350 K691E probably benign Het
Tmco4 T C 4: 139,053,920 F465S probably damaging Het
Tmem245 A G 4: 56,926,213 S290P probably benign Het
Top2a T C 11: 99,003,590 T972A probably benign Het
Tpr T A 1: 150,410,147 S527R probably damaging Het
Traf2 T C 2: 25,519,609 D443G probably damaging Het
Trim40 A T 17: 36,883,147 probably null Het
Trim42 A T 9: 97,363,403 I448N possibly damaging Het
Ttll9 G A 2: 152,983,134 V78M probably damaging Het
Vav1 C T 17: 57,296,039 L88F probably damaging Het
Vps13b A G 15: 35,423,155 D207G probably damaging Het
Wdsub1 A G 2: 59,876,665 probably null Het
Zfp799 A G 17: 32,821,035 W85R possibly damaging Het
Zfp839 A T 12: 110,858,769 probably benign Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 7993065 splice site probably benign
IGL00421:Apob APN 12 8010197 missense probably damaging 0.99
IGL00658:Apob APN 12 8009471 missense probably benign 0.08
IGL00768:Apob APN 12 8002107 missense probably damaging 1.00
IGL00833:Apob APN 12 8010101 missense probably benign 0.14
IGL00926:Apob APN 12 8015421 missense probably benign 0.01
IGL01065:Apob APN 12 8003299 missense probably damaging 0.99
IGL01313:Apob APN 12 8000898 missense probably damaging 1.00
IGL01419:Apob APN 12 8002251 missense probably damaging 0.99
IGL01461:Apob APN 12 8001884 missense probably benign 0.13
IGL02002:Apob APN 12 7994822 missense probably benign 0.03
IGL02031:Apob APN 12 8015222 missense probably benign
IGL02102:Apob APN 12 7989407 missense possibly damaging 0.94
IGL02115:Apob APN 12 7992923 missense probably benign 0.06
IGL02513:Apob APN 12 7992979 missense probably benign 0.01
IGL02967:Apob APN 12 8015366 nonsense probably null
IGL03005:Apob APN 12 7993059 splice site probably benign
IGL03011:Apob APN 12 7997883 missense probably damaging 1.00
IGL03116:Apob APN 12 8016350 missense probably damaging 0.98
IGL03215:Apob APN 12 8013818 missense possibly damaging 0.92
IGL03227:Apob APN 12 8016089 missense probably benign 0.04
Aesthete UTSW 12 8010080 nonsense probably null
Essence UTSW 12 8007769 nonsense probably null
Ethos UTSW 12 7990394 missense probably null 1.00
IGL02835:Apob UTSW 12 8015097 missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8005102 missense probably damaging 1.00
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0180:Apob UTSW 12 8008285 nonsense probably null
R0288:Apob UTSW 12 7990779 nonsense probably null
R0295:Apob UTSW 12 8002181 nonsense probably null
R0305:Apob UTSW 12 8012210 missense probably damaging 1.00
R0312:Apob UTSW 12 8009034 missense probably benign
R0324:Apob UTSW 12 8010521 missense probably benign 0.41
R0326:Apob UTSW 12 7990307 missense probably damaging 1.00
R0363:Apob UTSW 12 8010136 missense probably damaging 1.00
R0390:Apob UTSW 12 7988678 missense probably damaging 0.99
R0462:Apob UTSW 12 8000896 missense probably damaging 1.00
R0471:Apob UTSW 12 7990406 missense probably damaging 1.00
R0532:Apob UTSW 12 8016188 missense possibly damaging 0.48
R0548:Apob UTSW 12 8006282 missense probably damaging 1.00
R0560:Apob UTSW 12 8005101 missense probably damaging 1.00
R0595:Apob UTSW 12 8008369 missense probably benign 0.01
R0600:Apob UTSW 12 8006440 missense probably damaging 1.00
R0626:Apob UTSW 12 8016193 missense probably benign 0.45
R0685:Apob UTSW 12 8010742 missense probably benign
R0765:Apob UTSW 12 8016518 missense probably benign
R0790:Apob UTSW 12 8010245 missense probably damaging 1.00
R0918:Apob UTSW 12 7983941 missense probably benign 0.10
R0962:Apob UTSW 12 7989191 missense probably damaging 0.98
R1055:Apob UTSW 12 7994963 missense probably damaging 1.00
R1077:Apob UTSW 12 8006017 missense probably benign
R1143:Apob UTSW 12 8012354 missense probably benign 0.26
R1163:Apob UTSW 12 8011654 missense probably damaging 1.00
R1266:Apob UTSW 12 8006093 missense probably benign 0.37
R1434:Apob UTSW 12 8009715 missense probably damaging 1.00
R1442:Apob UTSW 12 7986165 missense probably benign 0.31
R1445:Apob UTSW 12 8016084 missense possibly damaging 0.48
R1459:Apob UTSW 12 8006047 missense probably benign
R1459:Apob UTSW 12 8011937 missense possibly damaging 0.92
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1508:Apob UTSW 12 8011481 missense possibly damaging 0.92
R1518:Apob UTSW 12 7989207 missense probably benign 0.01
R1531:Apob UTSW 12 7997880 missense possibly damaging 0.65
R1547:Apob UTSW 12 8003368 missense probably benign 0.08
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1682:Apob UTSW 12 8012365 missense probably benign 0.00
R1709:Apob UTSW 12 8009306 missense probably damaging 0.98
R1718:Apob UTSW 12 8016087 missense probably benign 0.02
R1752:Apob UTSW 12 7988766 missense probably benign 0.01
R1781:Apob UTSW 12 8009603 missense possibly damaging 0.96
R1818:Apob UTSW 12 8006834 missense probably damaging 0.98
R1818:Apob UTSW 12 8013064 missense possibly damaging 0.93
R1842:Apob UTSW 12 8011559 missense probably damaging 1.00
R1843:Apob UTSW 12 8007602 missense possibly damaging 0.65
R1853:Apob UTSW 12 8010928 nonsense probably null
R1990:Apob UTSW 12 8001039 missense probably damaging 1.00
R2016:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2017:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2023:Apob UTSW 12 8011090 missense probably benign 0.01
R2037:Apob UTSW 12 8007488 missense probably benign 0.37
R2054:Apob UTSW 12 8013134 missense probably damaging 1.00
R2057:Apob UTSW 12 8002164 nonsense probably null
R2085:Apob UTSW 12 8012240 missense probably damaging 1.00
R2159:Apob UTSW 12 8010081 missense probably benign 0.12
R2209:Apob UTSW 12 8007752 missense probably benign 0.28
R2249:Apob UTSW 12 8007499 missense probably damaging 1.00
R2254:Apob UTSW 12 8011256 missense possibly damaging 0.92
R2265:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2266:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2267:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2268:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2296:Apob UTSW 12 7994879 missense probably damaging 0.97
R2897:Apob UTSW 12 8010356 missense probably damaging 1.00
R3431:Apob UTSW 12 8010778 missense probably damaging 1.00
R3723:Apob UTSW 12 8006327 missense probably damaging 1.00
R3723:Apob UTSW 12 8011763 missense possibly damaging 0.46
R3899:Apob UTSW 12 8015849 missense possibly damaging 0.87
R4020:Apob UTSW 12 7994914 nonsense probably null
R4050:Apob UTSW 12 8015390 missense probably benign 0.02
R4351:Apob UTSW 12 7993054 missense probably benign 0.03
R4365:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4366:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4456:Apob UTSW 12 8015445 missense probably damaging 1.00
R4458:Apob UTSW 12 8015445 missense probably damaging 1.00
R4600:Apob UTSW 12 8008568 missense probably damaging 1.00
R4611:Apob UTSW 12 8011331 missense probably damaging 1.00
R4646:Apob UTSW 12 8012759 missense probably benign 0.21
R4678:Apob UTSW 12 7995585 missense probably damaging 1.00
R4685:Apob UTSW 12 8006456 missense probably benign 0.00
R4707:Apob UTSW 12 8006205 missense probably damaging 0.96
R4726:Apob UTSW 12 7990267 missense probably damaging 0.98
R4792:Apob UTSW 12 8008051 missense probably benign 0.26
R4822:Apob UTSW 12 8015741 missense probably benign 0.04
R4834:Apob UTSW 12 8014101 missense possibly damaging 0.49
R4835:Apob UTSW 12 8015391 missense possibly damaging 0.56
R4887:Apob UTSW 12 8013099 missense probably damaging 1.00
R4910:Apob UTSW 12 8007848 missense probably damaging 1.00
R5072:Apob UTSW 12 8008714 missense probably benign 0.00
R5073:Apob UTSW 12 8005219 critical splice donor site probably null
R5074:Apob UTSW 12 8005219 critical splice donor site probably null
R5101:Apob UTSW 12 8011934 missense probably benign 0.09
R5123:Apob UTSW 12 8007630 splice site probably null
R5133:Apob UTSW 12 8008898 missense probably damaging 0.99
R5135:Apob UTSW 12 8010086 missense probably damaging 1.00
R5137:Apob UTSW 12 8011384 missense possibly damaging 0.63
R5160:Apob UTSW 12 8012126 missense possibly damaging 0.90
R5173:Apob UTSW 12 8008238 missense probably benign 0.00
R5202:Apob UTSW 12 8013737 missense probably damaging 0.98
R5229:Apob UTSW 12 7977806 missense probably benign
R5292:Apob UTSW 12 8005912 missense probably benign 0.01
R5378:Apob UTSW 12 8011865 missense probably damaging 0.99
R5494:Apob UTSW 12 8011762 missense probably damaging 0.99
R5517:Apob UTSW 12 7990906 missense probably damaging 1.00
R5576:Apob UTSW 12 7998662 missense probably damaging 1.00
R5582:Apob UTSW 12 8010788 missense probably damaging 1.00
R5629:Apob UTSW 12 8007847 missense probably damaging 1.00
R5678:Apob UTSW 12 7991494 missense possibly damaging 0.92
R5732:Apob UTSW 12 8010353 missense probably benign 0.15
R5734:Apob UTSW 12 7988781 missense probably damaging 1.00
R5742:Apob UTSW 12 8007191 missense probably damaging 1.00
R5751:Apob UTSW 12 8012619 nonsense probably null
R5776:Apob UTSW 12 8006149 missense possibly damaging 0.57
R5778:Apob UTSW 12 8015074 missense probably benign 0.45
R5783:Apob UTSW 12 8001022 missense probably damaging 1.00
R5786:Apob UTSW 12 8015304 missense possibly damaging 0.48
R5837:Apob UTSW 12 8003277 missense probably benign 0.04
R5857:Apob UTSW 12 8015397 missense probably benign 0.00
R6029:Apob UTSW 12 8016243 missense probably damaging 0.99
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6086:Apob UTSW 12 8015164 missense probably benign
R6110:Apob UTSW 12 8011883 missense probably damaging 1.00
R6131:Apob UTSW 12 8015874 missense probably benign 0.17
R6157:Apob UTSW 12 8006077 missense probably benign
R6179:Apob UTSW 12 8005060 nonsense probably null
R6247:Apob UTSW 12 8001801 missense probably damaging 1.00
R6279:Apob UTSW 12 8007769 nonsense probably null
R6300:Apob UTSW 12 8007769 nonsense probably null
R6320:Apob UTSW 12 7989194 missense probably benign 0.27
R6339:Apob UTSW 12 8016188 missense probably damaging 0.99
R6353:Apob UTSW 12 8009421 missense probably damaging 1.00
R6395:Apob UTSW 12 8008507 missense probably benign 0.45
R6441:Apob UTSW 12 7987796 missense probably damaging 1.00
R6492:Apob UTSW 12 8008261 missense probably damaging 0.99
R6495:Apob UTSW 12 7990394 missense probably null 1.00
R6502:Apob UTSW 12 8001814 missense probably damaging 0.99
R6520:Apob UTSW 12 7983124 missense probably damaging 1.00
R6644:Apob UTSW 12 8009077 missense probably damaging 0.97
R6704:Apob UTSW 12 8010379 missense probably damaging 0.98
R6750:Apob UTSW 12 7997853 missense probably damaging 1.00
R6759:Apob UTSW 12 8011049 missense probably benign 0.06
R6812:Apob UTSW 12 7983062 missense probably damaging 0.98
R6865:Apob UTSW 12 8008847 missense probably benign 0.05
R6873:Apob UTSW 12 8015995 missense probably benign 0.00
R7013:Apob UTSW 12 8010080 nonsense probably null
R7067:Apob UTSW 12 8009423 missense probably damaging 1.00
R7084:Apob UTSW 12 8009591 missense probably benign
R7113:Apob UTSW 12 7995539 missense probably damaging 1.00
R7175:Apob UTSW 12 8007034 missense probably benign 0.33
R7196:Apob UTSW 12 7983893 missense possibly damaging 0.90
R7199:Apob UTSW 12 8005072 missense probably damaging 1.00
R7205:Apob UTSW 12 8005087 missense probably damaging 0.98
R7251:Apob UTSW 12 8007037 missense probably damaging 0.98
R7474:Apob UTSW 12 8009185 missense probably benign 0.29
R7484:Apob UTSW 12 8006884 nonsense probably null
R7538:Apob UTSW 12 8002219 missense probably damaging 0.98
R7636:Apob UTSW 12 8009516 missense possibly damaging 0.86
R7646:Apob UTSW 12 8009189 missense probably damaging 0.99
R7787:Apob UTSW 12 7990780 missense probably damaging 0.97
R7793:Apob UTSW 12 8008124 missense probably damaging 0.99
R7836:Apob UTSW 12 8001885 missense possibly damaging 0.72
R7895:Apob UTSW 12 8011933 missense probably benign 0.00
R8005:Apob UTSW 12 8009744 missense probably benign 0.01
R8013:Apob UTSW 12 8010798 missense possibly damaging 0.94
R8014:Apob UTSW 12 8010798 missense possibly damaging 0.94
R8111:Apob UTSW 12 8008801 missense probably benign 0.16
R8117:Apob UTSW 12 8006435 missense probably damaging 0.99
R8226:Apob UTSW 12 8009056 missense probably benign 0.00
R8244:Apob UTSW 12 8010548 missense probably damaging 0.96
R8280:Apob UTSW 12 8010851 missense possibly damaging 0.46
R8310:Apob UTSW 12 8009033 missense probably benign 0.00
R8327:Apob UTSW 12 8001015 missense possibly damaging 0.72
R8329:Apob UTSW 12 8011135 missense probably damaging 0.98
R8331:Apob UTSW 12 8001882 missense probably benign 0.28
R8351:Apob UTSW 12 8006356 missense probably benign 0.29
R8412:Apob UTSW 12 8008069 missense probably benign 0.33
R8425:Apob UTSW 12 7988842 missense possibly damaging 0.70
R8493:Apob UTSW 12 8009009 missense possibly damaging 0.87
R8529:Apob UTSW 12 8007353 missense probably damaging 1.00
R8554:Apob UTSW 12 7987830 missense probably damaging 0.98
X0027:Apob UTSW 12 8007975 missense probably benign
Z1088:Apob UTSW 12 8005074 missense possibly damaging 0.91
Z1088:Apob UTSW 12 8005945 nonsense probably null
Z1088:Apob UTSW 12 8012936 missense possibly damaging 0.95
Z1176:Apob UTSW 12 7998011 missense probably damaging 1.00
Z1176:Apob UTSW 12 8004978 missense probably benign 0.00
Z1177:Apob UTSW 12 7988765 missense probably benign 0.43
Z1177:Apob UTSW 12 8015249 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGATGGCTCTGATCCCAAATCC -3'
(R):5'- ACGTGAAATACGGCGAGAATACCC -3'

Sequencing Primer
(F):5'- CATCTCTTGTCCTGAGAGAAAAGG -3'
(R):5'- TACCCTCAGAATCAAGAAGGTGTG -3'
Posted On2013-04-11