Mutagenetix > Incidental Mutation

Incidental Mutation 'R1852:Prune2'

208278

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

MMRRC Submission

039876-MU

Accession Numbers

Genbank: NM_181348

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1852 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17199139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 154 (I154V)

Ref Sequence

ENSEMBL: ENSMUSP00000153135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689] [ENSMUST00000223920] [ENSMUST00000225351]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087689
AA Change: I2903V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: I2903V

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223920
AA Change: I154V

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224059

Predicted Effect

probably damaging
Transcript: ENSMUST00000225351
AA Change: I154V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000226052
AA Change: I180V

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,268,473	D499G	probably damaging	Het
2900092C05Rik	A	G	7: 12,512,702		probably null	Het
4930433I11Rik	T	A	7: 40,993,613	D326E	probably benign	Het
A530032D15Rik	G	A	1: 85,085,131		probably benign	Het
Abca8a	T	C	11: 110,069,386	D676G	probably damaging	Het
Abcb7	T	C	X: 104,305,399	M153V	probably benign	Het
Ablim3	G	A	18: 61,849,395	H160Y	probably benign	Het
Acsl6	T	C	11: 54,361,076	I683T	probably damaging	Het
Adgrg5	A	T	8: 94,937,800	Y345F	probably damaging	Het
Alg6	T	G	4: 99,746,362	F114V	probably benign	Het
Ank2	A	C	3: 126,997,851		probably null	Het
Ankrd24	A	T	10: 81,642,941		probably benign	Het
Ano8	T	C	8: 71,483,487	K222E	probably damaging	Het
Arhgef5	T	C	6: 43,275,185	S957P	probably benign	Het
Bmpr1b	A	T	3: 141,857,402		probably null	Het
C3	A	G	17: 57,222,823	V2A	probably damaging	Het
Capn1	A	G	19: 6,009,103	V276A	possibly damaging	Het
Ccdc57	T	C	11: 120,921,673	E85G	probably damaging	Het
Chil3	C	T	3: 106,148,801		probably null	Het
Chl1	A	T	6: 103,699,159		probably null	Het
Chodl	C	T	16: 78,941,258	P38L	probably benign	Het
Clec4a2	G	T	6: 123,139,125	E124*	probably null	Het
Cmtr1	T	C	17: 29,702,255	V825A	probably benign	Het
Cnksr3	T	C	10: 7,120,539	I232V	probably benign	Het
Cntn1	C	T	15: 92,305,140	R768C	probably damaging	Het
Col15a1	G	T	4: 47,299,278		probably null	Het
Col6a3	T	A	1: 90,807,534	I798F	possibly damaging	Het
Cpxcr1	T	A	X: 116,478,061	L223*	probably null	Het
Cul1	A	G	6: 47,520,830	N615S	probably damaging	Het
Cxcr2	A	G	1: 74,159,279	I311V	probably benign	Het
Cyp2c67	C	T	19: 39,617,367	G362S	probably benign	Het
D930048N14Rik	T	A	11: 51,653,865		probably benign	Het
Ddx49	T	C	8: 70,300,983	T79A	probably damaging	Het
Defb46	T	A	8: 19,239,975		probably null	Het
Dnah17	T	A	11: 118,121,916	I145F	probably damaging	Het
Dock8	A	T	19: 25,127,128	I725F	probably benign	Het
Dppa4	G	A	16: 48,287,884	A11T	probably damaging	Het
Enam	T	A	5: 88,504,465	S1278T	possibly damaging	Het
Fndc3a	A	G	14: 72,556,843	V829A	probably damaging	Het
Gatb	T	G	3: 85,618,877	L354R	probably damaging	Het
Gm10787	A	T	10: 77,021,877		noncoding transcript	Het
Gm13084	T	C	4: 143,812,826	I32M	probably benign	Het
Gsap	T	A	5: 21,290,545		probably null	Het
Gtf2ird1	T	C	5: 134,382,580		probably null	Het
Has3	A	T	8: 106,874,079	I58F	probably damaging	Het
Haus5	A	T	7: 30,658,501		probably null	Het
Hip1r	T	C	5: 123,991,505	V169A	probably benign	Het
Hnf1a	T	A	5: 114,970,711	D45V	probably damaging	Het
Il20ra	T	A	10: 19,743,019	Y72N	probably damaging	Het
Ipo11	A	T	13: 106,812,257	V914E	possibly damaging	Het
Itpr1	T	C	6: 108,386,706	L763P	probably damaging	Het
Katnal2	C	A	18: 77,016,023	R104L	probably benign	Het
Kcng4	G	T	8: 119,626,208	P321Q	probably benign	Het
Larp4b	T	C	13: 9,137,303		probably null	Het
Lars	T	C	18: 42,212,608	N1001S	probably benign	Het
Lhcgr	T	A	17: 88,765,176	I148F	probably damaging	Het
Lsm10	T	A	4: 126,097,963	S37R	possibly damaging	Het
Mfsd13a	A	G	19: 46,372,180		probably null	Het
Mipep	T	A	14: 60,843,240	C560*	probably null	Het
Mme	A	G	3: 63,327,983	S97G	probably benign	Het
Mme	G	A	3: 63,328,046	D172N	probably benign	Het
Mx1	A	T	16: 97,448,203	L608Q	probably damaging	Het
Myt1l	T	C	12: 29,851,661	M208T	probably benign	Het
Neb	T	C	2: 52,228,542	I3987V	probably damaging	Het
Nelfcd	A	G	2: 174,423,978		probably null	Het
Neto1	T	C	18: 86,395,884	M1T	probably null	Het
Nom1	T	C	5: 29,446,878	F738S	possibly damaging	Het
Olfr1137	T	C	2: 87,710,973		probably null	Het
Olfr1160	T	G	2: 88,006,521	I86L	probably damaging	Het
Olfr1314	C	A	2: 112,091,847	V285L	probably benign	Het
Olfr1420	C	A	19: 11,896,885	P288H	probably damaging	Het
Olfr1487	C	T	19: 13,619,603	S147F	probably damaging	Het
Olfr523	T	A	7: 140,176,561	L147*	probably null	Het
Olfr572	C	T	7: 102,928,441	S271L	probably damaging	Het
Olfr772	T	C	10: 129,174,328	K231R	probably benign	Het
Pak1ip1	A	G	13: 41,011,232	T264A	possibly damaging	Het
Palb2	G	T	7: 122,114,314	D915E	possibly damaging	Het
Pank4	T	C	4: 154,976,359	L491P	probably damaging	Het
Paqr7	T	C	4: 134,507,669	V279A	probably benign	Het
Pcif1	G	A	2: 164,888,466	R373Q	probably damaging	Het
Pdgfa	T	A	5: 138,979,172	N185I	probably benign	Het
Plcd4	T	C	1: 74,549,361	V123A	possibly damaging	Het
Rac3	T	G	11: 120,723,494	L148R	possibly damaging	Het
Rapgef6	T	A	11: 54,642,811	D362E	probably benign	Het
Rbl1	A	G	2: 157,174,903	I592T	probably benign	Het
Rbl2	A	C	8: 91,095,563	D408A	possibly damaging	Het
Retreg2	A	G	1: 75,146,675	K416E	probably benign	Het
Rorb	A	T	19: 18,962,083	L234H	probably damaging	Het
Rpp40	T	G	13: 35,896,914	D279A	probably benign	Het
Siglec1	C	A	2: 131,081,500	V442L	probably damaging	Het
Sik3	C	G	9: 46,221,089	H1276Q	probably benign	Het
Skiv2l2	A	T	13: 112,872,927	H979Q	probably benign	Het
Slc25a34	G	A	4: 141,622,268	T192I	probably benign	Het
Sptbn5	T	C	2: 120,071,644	I126M	possibly damaging	Het
Strada	A	G	11: 106,171,221	V94A	possibly damaging	Het
Stxbp5	C	A	10: 9,812,298	V420F	possibly damaging	Het
Tcrg-C3	A	T	13: 19,261,091	M70L	probably damaging	Het
Tgm1	T	C	14: 55,704,941	Y651C	probably damaging	Het
Tmem200c	T	A	17: 68,840,617	V65E	probably damaging	Het
Tmem74	A	T	15: 43,867,163	D161E	probably benign	Het
Vcan	T	G	13: 89,705,392	E483A	probably damaging	Het
Vmn2r124	A	G	17: 18,063,174	T377A	probably benign	Het
Vmn2r3	A	C	3: 64,259,394	I772S	probably damaging	Het
Wdfy3	A	G	5: 101,915,376	V1342A	probably benign	Het
Zfp507	T	C	7: 35,787,751	H764R	probably damaging	Het
Znrf3	A	G	11: 5,287,455	I218T	possibly damaging	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0531:Prune2	UTSW	19	17006753	missense	probably damaging	1.00
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0554:Prune2	UTSW	19	17125218	nonsense	probably null
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1838:Prune2	UTSW	19	17199878	missense	probably damaging	1.00
R1851:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1911:Prune2	UTSW	19	17113674	missense	probably benign	0.02
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2111:Prune2	UTSW	19	17208238	missense	probably damaging	1.00
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4022:Prune2	UTSW	19	17000020	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4922:Prune2	UTSW	19	17122752	missense	probably benign	0.00
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
R7872:Prune2	UTSW	19	17119434	missense	probably benign	0.05
R7881:Prune2	UTSW	19	17123029	missense	possibly damaging	0.50
R7966:Prune2	UTSW	19	17178859	missense	probably damaging	0.99
R7969:Prune2	UTSW	19	17201670	missense	probably damaging	0.98
R8092:Prune2	UTSW	19	17119993	missense	probably damaging	1.00
R8110:Prune2	UTSW	19	17120719	missense	probably benign	0.22
R8115:Prune2	UTSW	19	17123924	missense	probably benign	0.02
R8129:Prune2	UTSW	19	17118836	missense	probably benign	0.01
R8169:Prune2	UTSW	19	17125091	missense	probably benign	0.10
R8171:Prune2	UTSW	19	17120518	missense	probably damaging	1.00
R8176:Prune2	UTSW	19	17118292	missense	probably damaging	1.00
R8200:Prune2	UTSW	19	17124973	missense	probably benign	0.01
R8217:Prune2	UTSW	19	17120116	missense	probably benign	0.01
R8258:Prune2	UTSW	19	17212308	missense	unknown
R8259:Prune2	UTSW	19	17212308	missense	unknown
R8289:Prune2	UTSW	19	17123009	missense	probably benign	0.43
R8329:Prune2	UTSW	19	17121265	missense	probably benign	0.02
R8342:Prune2	UTSW	19	17125663	missense	probably benign	0.01
R8558:Prune2	UTSW	19	17122238	missense	probably damaging	0.98
R8732:Prune2	UTSW	19	17120405	missense	probably damaging	1.00
R8743:Prune2	UTSW	19	17119556	missense	probably benign	0.22
R8769:Prune2	UTSW	19	17123078	missense	probably damaging	0.96
R8862:Prune2	UTSW	19	17120146	missense	probably benign	0.04
R8936:Prune2	UTSW	19	17121835	missense	probably benign	0.24
R9040:Prune2	UTSW	19	17120627	missense	probably damaging	1.00
R9084:Prune2	UTSW	19	17120377	missense	probably damaging	1.00
R9224:Prune2	UTSW	19	17120029	missense	probably damaging	1.00
R9273:Prune2	UTSW	19	17118326	missense	possibly damaging	0.74
R9275:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9278:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9290:Prune2	UTSW	19	17168327	missense	probably benign	0.41
R9305:Prune2	UTSW	19	17120261	missense	probably benign	0.14
R9317:Prune2	UTSW	19	17121670	missense	probably benign	0.00
R9354:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R9373:Prune2	UTSW	19	17122138	missense	probably benign
R9394:Prune2	UTSW	19	17003689	missense	probably damaging	1.00
R9405:Prune2	UTSW	19	17216344	missense	probably damaging	0.99
R9476:Prune2	UTSW	19	17119342	missense	possibly damaging	0.64
R9532:Prune2	UTSW	19	17122430	missense	probably benign	0.00
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTACCCCTCACTATGCTTG -3'
(R):5'- GAACAGAGTTCCCTAGGGCAAG -3'

Sequencing Primer
(F):5'- GCTTGCTCATTTTATGATACAGTGC -3'
(R):5'- AGGCTCTGTGACTGAAATCC -3'

Posted On

2014-06-23