Incidental Mutation 'R1852:Dock8'
ID208280
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Namededicator of cytokinesis 8
SynonymsA130095G14Rik, 5830472H07Rik, 1200017A24Rik
MMRRC Submission 039876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1852 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location24999529-25202432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25127128 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 725 (I725F)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
PDB Structure
Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: I725F

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: I725F

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,268,473 D499G probably damaging Het
2900092C05Rik A G 7: 12,512,702 probably null Het
4930433I11Rik T A 7: 40,993,613 D326E probably benign Het
A530032D15Rik G A 1: 85,085,131 probably benign Het
Abca8a T C 11: 110,069,386 D676G probably damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acsl6 T C 11: 54,361,076 I683T probably damaging Het
Adgrg5 A T 8: 94,937,800 Y345F probably damaging Het
Alg6 T G 4: 99,746,362 F114V probably benign Het
Ank2 A C 3: 126,997,851 probably null Het
Ankrd24 A T 10: 81,642,941 probably benign Het
Ano8 T C 8: 71,483,487 K222E probably damaging Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Bmpr1b A T 3: 141,857,402 probably null Het
C3 A G 17: 57,222,823 V2A probably damaging Het
Capn1 A G 19: 6,009,103 V276A possibly damaging Het
Ccdc57 T C 11: 120,921,673 E85G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chl1 A T 6: 103,699,159 probably null Het
Chodl C T 16: 78,941,258 P38L probably benign Het
Clec4a2 G T 6: 123,139,125 E124* probably null Het
Cmtr1 T C 17: 29,702,255 V825A probably benign Het
Cnksr3 T C 10: 7,120,539 I232V probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col15a1 G T 4: 47,299,278 probably null Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cul1 A G 6: 47,520,830 N615S probably damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cyp2c67 C T 19: 39,617,367 G362S probably benign Het
D930048N14Rik T A 11: 51,653,865 probably benign Het
Ddx49 T C 8: 70,300,983 T79A probably damaging Het
Defb46 T A 8: 19,239,975 probably null Het
Dnah17 T A 11: 118,121,916 I145F probably damaging Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Enam T A 5: 88,504,465 S1278T possibly damaging Het
Fndc3a A G 14: 72,556,843 V829A probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gm10787 A T 10: 77,021,877 noncoding transcript Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gsap T A 5: 21,290,545 probably null Het
Gtf2ird1 T C 5: 134,382,580 probably null Het
Has3 A T 8: 106,874,079 I58F probably damaging Het
Haus5 A T 7: 30,658,501 probably null Het
Hip1r T C 5: 123,991,505 V169A probably benign Het
Hnf1a T A 5: 114,970,711 D45V probably damaging Het
Il20ra T A 10: 19,743,019 Y72N probably damaging Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Itpr1 T C 6: 108,386,706 L763P probably damaging Het
Katnal2 C A 18: 77,016,023 R104L probably benign Het
Kcng4 G T 8: 119,626,208 P321Q probably benign Het
Larp4b T C 13: 9,137,303 probably null Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lhcgr T A 17: 88,765,176 I148F probably damaging Het
Lsm10 T A 4: 126,097,963 S37R possibly damaging Het
Mfsd13a A G 19: 46,372,180 probably null Het
Mipep T A 14: 60,843,240 C560* probably null Het
Mme A G 3: 63,327,983 S97G probably benign Het
Mme G A 3: 63,328,046 D172N probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myt1l T C 12: 29,851,661 M208T probably benign Het
Neb T C 2: 52,228,542 I3987V probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Neto1 T C 18: 86,395,884 M1T probably null Het
Nom1 T C 5: 29,446,878 F738S possibly damaging Het
Olfr1137 T C 2: 87,710,973 probably null Het
Olfr1160 T G 2: 88,006,521 I86L probably damaging Het
Olfr1314 C A 2: 112,091,847 V285L probably benign Het
Olfr1420 C A 19: 11,896,885 P288H probably damaging Het
Olfr1487 C T 19: 13,619,603 S147F probably damaging Het
Olfr523 T A 7: 140,176,561 L147* probably null Het
Olfr572 C T 7: 102,928,441 S271L probably damaging Het
Olfr772 T C 10: 129,174,328 K231R probably benign Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Palb2 G T 7: 122,114,314 D915E possibly damaging Het
Pank4 T C 4: 154,976,359 L491P probably damaging Het
Paqr7 T C 4: 134,507,669 V279A probably benign Het
Pcif1 G A 2: 164,888,466 R373Q probably damaging Het
Pdgfa T A 5: 138,979,172 N185I probably benign Het
Plcd4 T C 1: 74,549,361 V123A possibly damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rac3 T G 11: 120,723,494 L148R possibly damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Rbl1 A G 2: 157,174,903 I592T probably benign Het
Rbl2 A C 8: 91,095,563 D408A possibly damaging Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Rorb A T 19: 18,962,083 L234H probably damaging Het
Rpp40 T G 13: 35,896,914 D279A probably benign Het
Siglec1 C A 2: 131,081,500 V442L probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skiv2l2 A T 13: 112,872,927 H979Q probably benign Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Sptbn5 T C 2: 120,071,644 I126M possibly damaging Het
Strada A G 11: 106,171,221 V94A possibly damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Tcrg-C3 A T 13: 19,261,091 M70L probably damaging Het
Tgm1 T C 14: 55,704,941 Y651C probably damaging Het
Tmem200c T A 17: 68,840,617 V65E probably damaging Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Vcan T G 13: 89,705,392 E483A probably damaging Het
Vmn2r124 A G 17: 18,063,174 T377A probably benign Het
Vmn2r3 A C 3: 64,259,394 I772S probably damaging Het
Wdfy3 A G 5: 101,915,376 V1342A probably benign Het
Zfp507 T C 7: 35,787,751 H764R probably damaging Het
Znrf3 A G 11: 5,287,455 I218T possibly damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
Pap UTSW 19 25122441 missense probably benign 0.31
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null 0.95
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R7942:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7947:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R7980:Dock8 UTSW 19 25131933 intron probably null
X0027:Dock8 UTSW 19 25161129 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTAGAGCCTTGCCATTC -3'
(R):5'- GAAATCTCAGATGCTTCCAGC -3'

Sequencing Primer
(F):5'- TAGAGCCTTGCCATTCCTGACATG -3'
(R):5'- GCTTCCAGCAAAGGCAGTG -3'
Posted On2014-06-23