Incidental Mutation 'R1853:Zdbf2'
ID 208289
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 039877-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R1853 (G1)
Quality Score 107
Status Not validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GAAAAA to GAAAAAA at 63344701 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect probably null
Transcript: ENSMUST00000029025
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114132
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 69,901,696 (GRCm39) K554E probably damaging Het
Acap2 C T 16: 30,936,122 (GRCm39) E322K probably damaging Het
Adam32 T C 8: 25,388,642 (GRCm39) Y354C probably benign Het
Agl A T 3: 116,572,971 (GRCm39) Y789* probably null Het
Aida A G 1: 183,087,380 (GRCm39) T68A probably benign Het
Aldh3b3 T A 19: 4,015,822 (GRCm39) L264Q probably damaging Het
Anks6 T C 4: 47,049,387 (GRCm39) T173A probably benign Het
Ankzf1 A G 1: 75,174,772 (GRCm39) probably null Het
Apob A T 12: 8,060,928 (GRCm39) K3137* probably null Het
Arhgef16 C T 4: 154,375,563 (GRCm39) V144I probably benign Het
Arhgef2 A T 3: 88,540,222 (GRCm39) T107S possibly damaging Het
Ark2c T A 18: 77,550,671 (GRCm39) S279C possibly damaging Het
Atad2 G A 15: 57,960,685 (GRCm39) P971L possibly damaging Het
Atp6ap1l T C 13: 91,031,707 (GRCm39) E325G probably damaging Het
BC035947 T C 1: 78,475,653 (GRCm39) N293S possibly damaging Het
Bhmt C T 13: 93,761,843 (GRCm39) V147M probably damaging Het
Ccdc112 A T 18: 46,418,767 (GRCm39) H447Q probably benign Het
Cd274 T A 19: 29,357,882 (GRCm39) N191K probably damaging Het
Ckmt1 C T 2: 121,191,131 (GRCm39) T181I probably damaging Het
Cnih3 C A 1: 181,282,186 (GRCm39) S140* probably null Het
Col28a1 T G 6: 8,014,574 (GRCm39) I944L probably benign Het
Cttnbp2 T C 6: 18,408,601 (GRCm39) T1007A probably benign Het
Cux2 G T 5: 122,007,184 (GRCm39) P826T possibly damaging Het
Cyren A G 6: 34,852,494 (GRCm39) V67A probably damaging Het
Dap3 A T 3: 88,838,233 (GRCm39) V86E probably damaging Het
Ddah1 A G 3: 145,597,304 (GRCm39) I180M probably benign Het
Ddt T C 10: 75,609,138 (GRCm39) E7G possibly damaging Het
Dhx57 A T 17: 80,582,308 (GRCm39) Y432* probably null Het
Dpp9 T C 17: 56,509,885 (GRCm39) I314V probably benign Het
Enpp2 C T 15: 54,709,219 (GRCm39) E803K probably damaging Het
Ercc6 T A 14: 32,298,773 (GRCm39) I1387N possibly damaging Het
Fancg T C 4: 43,009,727 (GRCm39) E57G probably benign Het
Fcgbpl1 C T 7: 27,854,971 (GRCm39) Q1866* probably null Het
Fkbp5 A T 17: 28,648,281 (GRCm39) C103S possibly damaging Het
Gm14403 C A 2: 177,200,932 (GRCm39) H293N probably damaging Het
Gm4353 G A 7: 115,682,804 (GRCm39) P259L probably benign Het
Gm4787 T A 12: 81,425,108 (GRCm39) H350L probably damaging Het
Hibch T C 1: 52,940,494 (GRCm39) probably null Het
Impg2 T C 16: 56,080,640 (GRCm39) S815P probably damaging Het
Ipo11 A T 13: 106,997,395 (GRCm39) I688K probably benign Het
Kcnd3 A T 3: 105,367,068 (GRCm39) T313S probably damaging Het
Kctd14 A T 7: 97,102,631 (GRCm39) S38C possibly damaging Het
Kdm3b G T 18: 34,966,446 (GRCm39) R1660L probably damaging Het
Kdr C T 5: 76,113,565 (GRCm39) G768S possibly damaging Het
Klhl2 G A 8: 65,275,658 (GRCm39) H82Y probably benign Het
Lama3 A T 18: 12,646,762 (GRCm39) T1759S possibly damaging Het
Lamb1 T G 12: 31,368,271 (GRCm39) C1134G probably damaging Het
Macf1 T C 4: 123,406,513 (GRCm39) probably null Het
Mlph C T 1: 90,873,389 (GRCm39) Q567* probably null Het
Mocos A C 18: 24,829,026 (GRCm39) E777A probably damaging Het
Neil1 T A 9: 57,051,999 (GRCm39) Q214L probably damaging Het
Nes A G 3: 87,883,114 (GRCm39) T458A possibly damaging Het
Nlgn1 A T 3: 26,187,671 (GRCm39) N71K possibly damaging Het
Nr4a1 T C 15: 101,169,645 (GRCm39) I305T probably benign Het
Nup58 T C 14: 60,481,996 (GRCm39) T123A possibly damaging Het
Oas1c A T 5: 120,946,060 (GRCm39) V146E probably damaging Het
Oit3 C T 10: 59,277,444 (GRCm39) probably null Het
Or12k8 A T 2: 36,975,232 (GRCm39) F176Y probably damaging Het
Or4k15c A G 14: 50,321,577 (GRCm39) L187P probably damaging Het
Osbp T C 19: 11,951,255 (GRCm39) S267P possibly damaging Het
Pclo T A 5: 14,726,698 (GRCm39) probably benign Het
Pde9a C T 17: 31,674,094 (GRCm39) P60S probably damaging Het
Pdia3 T C 2: 121,262,144 (GRCm39) I205T probably benign Het
Pdia4 A T 6: 47,790,161 (GRCm39) D26E unknown Het
Pds5a A G 5: 65,781,372 (GRCm39) V1036A possibly damaging Het
Pitx3 C T 19: 46,125,912 (GRCm39) G4R probably benign Het
Pnn T A 12: 59,118,399 (GRCm39) N327K probably damaging Het
Pole T G 5: 110,454,719 (GRCm39) I984R possibly damaging Het
Psme2 T A 14: 55,825,936 (GRCm39) I124F probably damaging Het
Pstpip2 T A 18: 77,959,499 (GRCm39) L198Q probably damaging Het
Siglece A G 7: 43,309,360 (GRCm39) F66S probably benign Het
Slc1a6 T A 10: 78,648,758 (GRCm39) V493E probably damaging Het
Snd1 T A 6: 28,545,563 (GRCm39) I373N probably damaging Het
Srrm2 A G 17: 24,039,499 (GRCm39) T2144A probably damaging Het
Sst A G 16: 23,709,403 (GRCm39) L31P probably damaging Het
Stab1 C T 14: 30,862,420 (GRCm39) V2305M probably damaging Het
Stard9 T C 2: 120,519,232 (GRCm39) I545T probably damaging Het
Tcaim T C 9: 122,655,271 (GRCm39) W248R probably damaging Het
Tepsin A C 11: 119,989,462 (GRCm39) F13C probably damaging Het
Terf1 T A 1: 15,889,162 (GRCm39) L197* probably null Het
Tiam2 C T 17: 3,465,410 (GRCm39) R380C probably damaging Het
Tmem63b G A 17: 45,972,223 (GRCm39) H745Y possibly damaging Het
Trim40 A G 17: 37,199,970 (GRCm39) L36P probably damaging Het
Trim72 A G 7: 127,608,254 (GRCm39) I251V probably benign Het
Trio T C 15: 27,756,622 (GRCm39) Y914C probably damaging Het
Vmn2r113 G A 17: 23,164,501 (GRCm39) V135I probably benign Het
Vmn2r117 T A 17: 23,696,429 (GRCm39) H326L probably damaging Het
Vmn2r28 A T 7: 5,484,246 (GRCm39) C651* probably null Het
Xpnpep1 T C 19: 52,994,641 (GRCm39) E329G probably benign Het
Xpo4 G A 14: 57,823,364 (GRCm39) T1042M possibly damaging Het
Ypel1 A C 16: 16,925,087 (GRCm39) D28E probably benign Het
Zfp51 A T 17: 21,684,585 (GRCm39) H400L probably damaging Het
Zfp518b A T 5: 38,830,750 (GRCm39) F418L probably benign Het
Zfp54 T A 17: 21,654,404 (GRCm39) Y299* probably null Het
Zfp672 T C 11: 58,207,790 (GRCm39) H177R probably benign Het
Zfp692 C A 11: 58,200,805 (GRCm39) P229T possibly damaging Het
Zswim4 A T 8: 84,950,829 (GRCm39) C533S probably damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAAGCACGGAATCTCATTCTGAAG -3'
(R):5'- AAATGGCCAGTAGAATCAGCAC -3'

Sequencing Primer
(F):5'- GAAGTAAGTTCAGCTTCTACTGC -3'
(R):5'- AGAGTCACTGGGTTTGCCATC -3'
Posted On 2014-06-23