Mutagenetix > Incidental Mutation

Incidental Mutation 'R1853:Stard9'

208297

Institutional Source

Beutler Lab

Gene Symbol

Stard9

Ensembl Gene

ENSMUSG00000033705

Gene Name

START domain containing 9

Synonyms

E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin

MMRRC Submission

039877-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R1853 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120629121-120731895 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120688751 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 545 (I545T)

Ref Sequence

ENSEMBL: ENSMUSP00000136055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000180041]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000140843

SMART Domains

Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
FHA	63	115	2.8e-4	SMART
coiled coil region	334	354	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	866	871	N/A	INTRINSIC
low complexity region	1023	1035	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1765	1775	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2953	2963	N/A	INTRINSIC
low complexity region	3269	3281	N/A	INTRINSIC
low complexity region	3421	3435	N/A	INTRINSIC
coiled coil region	3767	3808	N/A	INTRINSIC
low complexity region	3812	3821	N/A	INTRINSIC
low complexity region	3827	3844	N/A	INTRINSIC
low complexity region	3904	3925	N/A	INTRINSIC
SCOP:d1jssa_	3946	4142	1e-28	SMART
Blast:START	3947	4143	1e-10	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000180041
AA Change: I545T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: I545T

Domain	Start	End	E-Value	Type
KISc	1	392	3.31e-143	SMART
low complexity region	398	409	N/A	INTRINSIC
FHA	481	533	2.8e-4	SMART
coiled coil region	752	772	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
low complexity region	1284	1289	N/A	INTRINSIC
low complexity region	1441	1453	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	2183	2193	N/A	INTRINSIC
low complexity region	2964	2977	N/A	INTRINSIC
low complexity region	3371	3381	N/A	INTRINSIC
low complexity region	3687	3699	N/A	INTRINSIC
low complexity region	3839	3853	N/A	INTRINSIC
coiled coil region	4185	4226	N/A	INTRINSIC
low complexity region	4230	4239	N/A	INTRINSIC
low complexity region	4245	4262	N/A	INTRINSIC
low complexity region	4322	4343	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110062M04Rik	A	G	6: 34,875,559	V67A	probably damaging	Het
9530053A07Rik	C	T	7: 28,155,546	Q1866*	probably null	Het
Acadvl	T	C	11: 70,010,870	K554E	probably damaging	Het
Acap2	C	T	16: 31,117,304	E322K	probably damaging	Het
Adam32	T	C	8: 24,898,626	Y354C	probably benign	Het
Agl	A	T	3: 116,779,322	Y789*	probably null	Het
Aida	A	G	1: 183,306,445	T68A	probably benign	Het
Aldh3b3	T	A	19: 3,965,822	L264Q	probably damaging	Het
Anks6	T	C	4: 47,049,387	T173A	probably benign	Het
Ankzf1	A	G	1: 75,198,128		probably null	Het
Apob	A	T	12: 8,010,928	K3137*	probably null	Het
Arhgef16	C	T	4: 154,291,106	V144I	probably benign	Het
Arhgef2	A	T	3: 88,632,915	T107S	possibly damaging	Het
Atad2	G	A	15: 58,097,289	P971L	possibly damaging	Het
Atp6ap1l	T	C	13: 90,883,588	E325G	probably damaging	Het
BC035947	T	C	1: 78,499,016	N293S	possibly damaging	Het
Bhmt	C	T	13: 93,625,335	V147M	probably damaging	Het
Ccdc112	A	T	18: 46,285,700	H447Q	probably benign	Het
Cd274	T	A	19: 29,380,482	N191K	probably damaging	Het
Ckmt1	C	T	2: 121,360,650	T181I	probably damaging	Het
Cnih3	C	A	1: 181,454,621	S140*	probably null	Het
Col28a1	T	G	6: 8,014,574	I944L	probably benign	Het
Cttnbp2	T	C	6: 18,408,602	T1007A	probably benign	Het
Cux2	G	T	5: 121,869,121	P826T	possibly damaging	Het
Dap3	A	T	3: 88,930,926	V86E	probably damaging	Het
Ddah1	A	G	3: 145,891,549	I180M	probably benign	Het
Ddt	T	C	10: 75,773,304	E7G	possibly damaging	Het
Dhx57	A	T	17: 80,274,879	Y432*	probably null	Het
Dpp9	T	C	17: 56,202,885	I314V	probably benign	Het
Enpp2	C	T	15: 54,845,823	E803K	probably damaging	Het
Ercc6	T	A	14: 32,576,816	I1387N	possibly damaging	Het
Fancg	T	C	4: 43,009,727	E57G	probably benign	Het
Fkbp5	A	T	17: 28,429,307	C103S	possibly damaging	Het
Gm14403	C	A	2: 177,509,139	H293N	probably damaging	Het
Gm4353	G	A	7: 116,083,569	P259L	probably benign	Het
Gm4787	T	A	12: 81,378,334	H350L	probably damaging	Het
Hibch	T	C	1: 52,901,335		probably null	Het
Impg2	T	C	16: 56,260,277	S815P	probably damaging	Het
Ipo11	A	T	13: 106,860,887	I688K	probably benign	Het
Kcnd3	A	T	3: 105,459,752	T313S	probably damaging	Het
Kctd14	A	T	7: 97,453,424	S38C	possibly damaging	Het
Kdm3b	G	T	18: 34,833,393	R1660L	probably damaging	Het
Kdr	C	T	5: 75,952,905	G768S	possibly damaging	Het
Klhl2	G	A	8: 64,823,006	H82Y	probably benign	Het
Lama3	A	T	18: 12,513,705	T1759S	possibly damaging	Het
Lamb1	T	G	12: 31,318,272	C1134G	probably damaging	Het
Macf1	T	C	4: 123,512,720		probably null	Het
Mlph	C	T	1: 90,945,667	Q567*	probably null	Het
Mocos	A	C	18: 24,695,969	E777A	probably damaging	Het
Neil1	T	A	9: 57,144,715	Q214L	probably damaging	Het
Nes	A	G	3: 87,975,807	T458A	possibly damaging	Het
Nlgn1	A	T	3: 26,133,522	N71K	possibly damaging	Het
Nr4a1	T	C	15: 101,271,764	I305T	probably benign	Het
Nupl1	T	C	14: 60,244,547	T123A	possibly damaging	Het
Oas1c	A	T	5: 120,807,995	V146E	probably damaging	Het
Oit3	C	T	10: 59,441,622		probably null	Het
Olfr361	A	T	2: 37,085,220	F176Y	probably damaging	Het
Olfr726	A	G	14: 50,084,120	L187P	probably damaging	Het
Osbp	T	C	19: 11,973,891	S267P	possibly damaging	Het
Pclo	T	A	5: 14,676,684		probably benign	Het
Pde9a	C	T	17: 31,455,120	P60S	probably damaging	Het
Pdia3	T	C	2: 121,431,663	I205T	probably benign	Het
Pdia4	A	T	6: 47,813,227	D26E	unknown	Het
Pds5a	A	G	5: 65,624,029	V1036A	possibly damaging	Het
Pitx3	C	T	19: 46,137,473	G4R	probably benign	Het
Pnn	T	A	12: 59,071,613	N327K	probably damaging	Het
Pole	T	G	5: 110,306,853	I984R	possibly damaging	Het
Ppil2	A	C	16: 17,107,223	D28E	probably benign	Het
Psme2	T	A	14: 55,588,479	I124F	probably damaging	Het
Pstpip2	T	A	18: 77,871,799	L198Q	probably damaging	Het
Rnf165	T	A	18: 77,462,975	S279C	possibly damaging	Het
Siglece	A	G	7: 43,659,936	F66S	probably benign	Het
Slc1a6	T	A	10: 78,812,924	V493E	probably damaging	Het
Snd1	T	A	6: 28,545,564	I373N	probably damaging	Het
Srrm2	A	G	17: 23,820,525	T2144A	probably damaging	Het
Sst	A	G	16: 23,890,653	L31P	probably damaging	Het
Stab1	C	T	14: 31,140,463	V2305M	probably damaging	Het
Tcaim	T	C	9: 122,826,206	W248R	probably damaging	Het
Tepsin	A	C	11: 120,098,636	F13C	probably damaging	Het
Terf1	T	A	1: 15,818,938	L197*	probably null	Het
Tiam2	C	T	17: 3,415,135	R380C	probably damaging	Het
Tmem63b	G	A	17: 45,661,297	H745Y	possibly damaging	Het
Trim40	A	G	17: 36,889,078	L36P	probably damaging	Het
Trim72	A	G	7: 128,009,082	I251V	probably benign	Het
Trio	T	C	15: 27,756,536	Y914C	probably damaging	Het
Vmn2r113	G	A	17: 22,945,527	V135I	probably benign	Het
Vmn2r117	T	A	17: 23,477,455	H326L	probably damaging	Het
Vmn2r28	A	T	7: 5,481,247	C651*	probably null	Het
Xpnpep1	T	C	19: 53,006,210	E329G	probably benign	Het
Xpo4	G	A	14: 57,585,907	T1042M	possibly damaging	Het
Zdbf2	GAAAAA	GAAAAAA	1: 63,305,542		probably null	Het
Zfp51	A	T	17: 21,464,323	H400L	probably damaging	Het
Zfp518b	A	T	5: 38,673,407	F418L	probably benign	Het
Zfp54	T	A	17: 21,434,142	Y299*	probably null	Het
Zfp672	T	C	11: 58,316,964	H177R	probably benign	Het
Zfp692	C	A	11: 58,309,979	P229T	possibly damaging	Het
Zswim4	A	T	8: 84,224,200	C533S	probably damaging	Het

Other mutations in Stard9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Stard9	APN	2	120701847	missense	possibly damaging	0.52
IGL01122:Stard9	APN	2	120698479	missense	possibly damaging	0.93
IGL01318:Stard9	APN	2	120698719	missense	possibly damaging	0.56
IGL01371:Stard9	APN	2	120701368	missense	probably benign	0.04
IGL01394:Stard9	APN	2	120706327	missense	possibly damaging	0.78
IGL01531:Stard9	APN	2	120673604	missense	possibly damaging	0.93
IGL01721:Stard9	APN	2	120703330	missense	probably damaging	1.00
IGL01810:Stard9	APN	2	120699084	missense	possibly damaging	0.95
IGL01829:Stard9	APN	2	120706446	missense	possibly damaging	0.59
IGL01916:Stard9	APN	2	120668016	missense	probably damaging	1.00
IGL02031:Stard9	APN	2	120702339	missense	probably benign	0.27
IGL02081:Stard9	APN	2	120664910	missense	probably damaging	0.98
IGL02558:Stard9	APN	2	120696907	missense	possibly damaging	0.95
IGL02646:Stard9	APN	2	120698992	missense	probably damaging	1.00
IGL02873:Stard9	APN	2	120713807	missense	probably damaging	1.00
IGL03195:Stard9	APN	2	120705802	missense	probably damaging	1.00
IGL03204:Stard9	APN	2	120705802	missense	probably damaging	1.00
FR4737:Stard9	UTSW	2	120696085	small insertion	probably benign
IGL03014:Stard9	UTSW	2	120702194	unclassified	probably benign
PIT4151001:Stard9	UTSW	2	120702756	nonsense	probably null
PIT4498001:Stard9	UTSW	2	120697435	missense	possibly damaging	0.86
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0038:Stard9	UTSW	2	120695832	missense	probably benign
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0116:Stard9	UTSW	2	120634255	missense	probably damaging	0.99
R0398:Stard9	UTSW	2	120696307	missense	probably benign	0.03
R0479:Stard9	UTSW	2	120697596	missense	probably damaging	1.00
R0556:Stard9	UTSW	2	120698923	missense	probably benign	0.09
R0589:Stard9	UTSW	2	120698547	missense	probably benign	0.00
R0609:Stard9	UTSW	2	120706306	missense	probably damaging	1.00
R0611:Stard9	UTSW	2	120699257	missense	probably benign	0.00
R0683:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0751:Stard9	UTSW	2	120697485	missense	probably benign	0.04
R0833:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0836:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0838:Stard9	UTSW	2	120700842	missense	probably damaging	1.00
R0848:Stard9	UTSW	2	120695823	missense	probably damaging	1.00
R0849:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0961:Stard9	UTSW	2	120693439	missense	probably benign	0.01
R0993:Stard9	UTSW	2	120705169	missense	probably damaging	1.00
R1005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1006:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1115:Stard9	UTSW	2	120692850	missense	probably benign	0.05
R1163:Stard9	UTSW	2	120696213	missense	possibly damaging	0.86
R1199:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1200:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1331:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1332:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1333:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1334:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1335:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1336:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1338:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1346:Stard9	UTSW	2	120713448	missense	probably damaging	1.00
R1370:Stard9	UTSW	2	120697477	missense	probably benign	0.11
R1384:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1401:Stard9	UTSW	2	120712847	splice site	probably benign
R1416:Stard9	UTSW	2	120700972	missense	probably benign	0.00
R1453:Stard9	UTSW	2	120666376	missense	probably damaging	1.00
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1525:Stard9	UTSW	2	120702052	missense	probably benign	0.09
R1538:Stard9	UTSW	2	120696711	missense	probably benign	0.25
R1614:Stard9	UTSW	2	120697675	missense	possibly damaging	0.95
R1654:Stard9	UTSW	2	120703722	missense	probably benign	0.37
R1658:Stard9	UTSW	2	120701542	missense	probably benign	0.02
R1686:Stard9	UTSW	2	120699492	missense	probably benign	0.00
R1797:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1803:Stard9	UTSW	2	120701489	missense	probably benign	0.24
R1806:Stard9	UTSW	2	120679453	splice site	probably null
R1847:Stard9	UTSW	2	120698489	missense	possibly damaging	0.51
R1892:Stard9	UTSW	2	120693708	missense	probably benign	0.01
R1906:Stard9	UTSW	2	120696427	missense	probably benign	0.00
R1907:Stard9	UTSW	2	120713812	missense	probably damaging	1.00
R1930:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1933:Stard9	UTSW	2	120698656	missense	possibly damaging	0.55
R1989:Stard9	UTSW	2	120701406	missense	probably benign
R1999:Stard9	UTSW	2	120692868	missense	probably damaging	0.99
R2004:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2005:Stard9	UTSW	2	120664945	missense	possibly damaging	0.90
R2005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2021:Stard9	UTSW	2	120704235	missense	probably benign	0.05
R2025:Stard9	UTSW	2	120702398	missense	probably benign	0.20
R2190:Stard9	UTSW	2	120714120	missense	probably benign	0.22
R2204:Stard9	UTSW	2	120698531	frame shift	probably null
R2422:Stard9	UTSW	2	120700284	missense	probably benign	0.29
R3401:Stard9	UTSW	2	120703689	missense	probably damaging	0.98
R3618:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3619:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3900:Stard9	UTSW	2	120713549	missense	possibly damaging	0.93
R3943:Stard9	UTSW	2	120698229	missense	probably benign	0.11
R4022:Stard9	UTSW	2	120704155	missense	probably benign	0.05
R4223:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4224:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4225:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4345:Stard9	UTSW	2	120701946	missense	probably benign	0.43
R4382:Stard9	UTSW	2	120634222	missense	probably damaging	1.00
R4453:Stard9	UTSW	2	120697791	missense	probably benign
R4499:Stard9	UTSW	2	120700241	missense	probably benign	0.05
R4524:Stard9	UTSW	2	120696445	missense	probably damaging	1.00
R4671:Stard9	UTSW	2	120698640	missense	probably damaging	0.98
R4701:Stard9	UTSW	2	120705713	missense	possibly damaging	0.85
R4744:Stard9	UTSW	2	120696123	missense	probably benign	0.01
R4822:Stard9	UTSW	2	120695941	missense	possibly damaging	0.94
R4847:Stard9	UTSW	2	120703113	missense	probably benign	0.18
R4863:Stard9	UTSW	2	120700860	missense	probably benign	0.00
R4898:Stard9	UTSW	2	120706419	nonsense	probably null
R5033:Stard9	UTSW	2	120693399	missense	probably benign	0.00
R5087:Stard9	UTSW	2	120697019	nonsense	probably null
R5157:Stard9	UTSW	2	120697861	missense	probably benign
R5213:Stard9	UTSW	2	120699226	missense	probably damaging	1.00
R5237:Stard9	UTSW	2	120699358	missense	probably damaging	0.96
R5257:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5258:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5273:Stard9	UTSW	2	120705087	missense	possibly damaging	0.94
R5286:Stard9	UTSW	2	120701947	missense	probably benign	0.43
R5288:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5292:Stard9	UTSW	2	120699145	missense	probably benign	0.17
R5328:Stard9	UTSW	2	120699230	missense	probably damaging	1.00
R5385:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5386:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5393:Stard9	UTSW	2	120702906	missense	possibly damaging	0.87
R5405:Stard9	UTSW	2	120693668	missense	probably benign	0.17
R5685:Stard9	UTSW	2	120705322	missense	probably damaging	1.00
R5749:Stard9	UTSW	2	120703786	missense	probably damaging	1.00
R5780:Stard9	UTSW	2	120703396	missense	probably benign	0.02
R5901:Stard9	UTSW	2	120701370	missense	probably damaging	1.00
R5941:Stard9	UTSW	2	120713558	missense	probably damaging	1.00
R5960:Stard9	UTSW	2	120699961	missense	probably benign	0.05
R5966:Stard9	UTSW	2	120697099	missense	probably damaging	1.00
R5967:Stard9	UTSW	2	120706894	missense	probably damaging	0.99
R6012:Stard9	UTSW	2	120704586	missense	probably damaging	1.00
R6019:Stard9	UTSW	2	120693715	frame shift	probably null
R6020:Stard9	UTSW	2	120693715	frame shift	probably null
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6090:Stard9	UTSW	2	120693654	missense	probably damaging	0.99
R6192:Stard9	UTSW	2	120696760	missense	probably damaging	0.99
R6228:Stard9	UTSW	2	120713750	missense	probably damaging	1.00
R6235:Stard9	UTSW	2	120713546	missense	probably damaging	1.00
R6280:Stard9	UTSW	2	120701127	missense	probably benign
R6338:Stard9	UTSW	2	120697485	missense	probably benign
R6344:Stard9	UTSW	2	120704320	missense	probably benign	0.12
R6364:Stard9	UTSW	2	120713429	missense	probably damaging	1.00
R6383:Stard9	UTSW	2	120666407	critical splice donor site	probably null
R6644:Stard9	UTSW	2	120695772	missense	probably benign	0.11
R6747:Stard9	UTSW	2	120698383	missense	possibly damaging	0.62
R6833:Stard9	UTSW	2	120701259	missense	probably damaging	1.00
R6836:Stard9	UTSW	2	120699843	missense	probably benign	0.15
R6861:Stard9	UTSW	2	120705186	missense	probably benign	0.09
R6872:Stard9	UTSW	2	120714068	nonsense	probably null
R6875:Stard9	UTSW	2	120697436	missense	probably benign	0.04
R6915:Stard9	UTSW	2	120702630	missense	probably benign	0.00
R6934:Stard9	UTSW	2	120697695	missense	probably benign	0.00
R6943:Stard9	UTSW	2	120702196	missense	probably benign	0.29
R7009:Stard9	UTSW	2	120697191	missense	probably benign	0.37
R7031:Stard9	UTSW	2	120700450	missense	possibly damaging	0.61
R7132:Stard9	UTSW	2	120679378	nonsense	probably null
R7151:Stard9	UTSW	2	120696142	missense	probably benign
R7154:Stard9	UTSW	2	120701314	missense	probably benign	0.00
R7154:Stard9	UTSW	2	120704542	missense	probably benign	0.02
R7165:Stard9	UTSW	2	120704158	missense	probably damaging	1.00
R7260:Stard9	UTSW	2	120706938	missense	possibly damaging	0.90
R7270:Stard9	UTSW	2	120634274	nonsense	probably null
R7282:Stard9	UTSW	2	120698503	missense	probably benign	0.00
R7344:Stard9	UTSW	2	120704686	missense	possibly damaging	0.90
R7347:Stard9	UTSW	2	120666534	missense	probably benign
R7359:Stard9	UTSW	2	120698280	missense	probably damaging	1.00
R7375:Stard9	UTSW	2	120665002	splice site	probably null
R7410:Stard9	UTSW	2	120701497	missense	probably benign	0.41
R7422:Stard9	UTSW	2	120702152	missense	probably benign	0.21
R7475:Stard9	UTSW	2	120688110	missense	probably damaging	1.00
R7523:Stard9	UTSW	2	120699597	missense	probably benign
R7553:Stard9	UTSW	2	120693808	splice site	probably null
R7624:Stard9	UTSW	2	120688146	missense	probably benign	0.15
R7761:Stard9	UTSW	2	120699379	missense	probably benign	0.00
R7794:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R7819:Stard9	UTSW	2	120700984	missense	probably damaging	1.00
R7823:Stard9	UTSW	2	120702106	missense	probably damaging	0.96
R7837:Stard9	UTSW	2	120703665	missense	probably benign	0.06
R7889:Stard9	UTSW	2	120704461	missense	probably benign	0.11
R7905:Stard9	UTSW	2	120696081	missense	not run
R7956:Stard9	UTSW	2	120705371	nonsense	probably null
R8013:Stard9	UTSW	2	120688101	missense	probably damaging	1.00
R8113:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8114:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8116:Stard9	UTSW	2	120664939	nonsense	probably null
R8117:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8118:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8170:Stard9	UTSW	2	120700048	missense	possibly damaging	0.76
R8300:Stard9	UTSW	2	120704769	missense	possibly damaging	0.71
R8333:Stard9	UTSW	2	120701789	missense	probably benign	0.00
R8337:Stard9	UTSW	2	120679825	missense	probably damaging	1.00
R8536:Stard9	UTSW	2	120714659	missense	possibly damaging	0.93
R8682:Stard9	UTSW	2	120703315	missense	possibly damaging	0.65
R8696:Stard9	UTSW	2	120701114	missense	probably benign	0.02
R8708:Stard9	UTSW	2	120703578	missense	probably damaging	1.00
R8732:Stard9	UTSW	2	120679961	missense	probably damaging	1.00
R8798:Stard9	UTSW	2	120704731	missense	probably benign	0.09
R8807:Stard9	UTSW	2	120705451	missense	probably damaging	1.00
R8807:Stard9	UTSW	2	120705462	missense	probably damaging	1.00
R8862:Stard9	UTSW	2	120703618	missense	probably benign
R8920:Stard9	UTSW	2	120702607	missense	probably damaging	0.96
R9026:Stard9	UTSW	2	120705802	missense	probably damaging	1.00
R9048:Stard9	UTSW	2	120677934	missense	probably damaging	0.99
R9049:Stard9	UTSW	2	120679937	missense	probably benign	0.30
R9152:Stard9	UTSW	2	120698587	missense	probably damaging	0.99
R9189:Stard9	UTSW	2	120703019	missense	possibly damaging	0.95
R9238:Stard9	UTSW	2	120697966	missense	probably damaging	1.00
R9372:Stard9	UTSW	2	120664939	nonsense	probably null
R9393:Stard9	UTSW	2	120688175	missense	possibly damaging	0.88
R9444:Stard9	UTSW	2	120664933	missense	probably damaging	1.00
R9514:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9515:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9516:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9570:Stard9	UTSW	2	120704233	missense	probably benign	0.02
R9649:Stard9	UTSW	2	120696154	missense	probably benign	0.20
R9789:Stard9	UTSW	2	120679936	missense	probably damaging	1.00
X0023:Stard9	UTSW	2	120702744	missense	probably benign	0.00
X0023:Stard9	UTSW	2	120702963	missense	possibly damaging	0.92
Z1176:Stard9	UTSW	2	120695818	missense	probably benign	0.01
Z1176:Stard9	UTSW	2	120696612	missense	probably benign
Z1176:Stard9	UTSW	2	120698322	missense	probably damaging	1.00
Z1177:Stard9	UTSW	2	120673676	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGAAGCTCAGAGCCTTCCTC -3'
(R):5'- TTCCAAAGAGCCACTACTGC -3'

Sequencing Primer
(F):5'- GAACTTTCTCGACTATACTACCTGG -3'
(R):5'- TACTGCCAAGAGCCTCTCC -3'

Posted On

2014-06-23