Incidental Mutation 'R0116:Zfp839'
ID 20830
Institutional Source Beutler Lab
Gene Symbol Zfp839
Ensembl Gene ENSMUSG00000021271
Gene Name zinc finger protein 839
Synonyms 2810455K09Rik
MMRRC Submission 038402-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R0116 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 12
Chromosomal Location 110816687-110836430 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to T at 110825203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170060] [ENSMUST00000221549] [ENSMUST00000222460]
AlphaFold E9PUU5
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000170060
SMART Domains Protein: ENSMUSP00000131841
Gene: ENSMUSG00000021271

DomainStartEndE-ValueType
low complexity region 271 278 N/A INTRINSIC
ZnF_C2H2 295 320 3.02e0 SMART
low complexity region 377 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181662
Predicted Effect probably benign
Transcript: ENSMUST00000221549
Predicted Effect probably benign
Transcript: ENSMUST00000222460
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 94% (95/101)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,202,066 (GRCm39) V152E probably damaging Het
Abca5 T G 11: 110,167,331 (GRCm39) E1495A probably damaging Het
Abcc12 G A 8: 87,261,627 (GRCm39) S668F probably benign Het
Adgrl4 A T 3: 151,223,247 (GRCm39) T608S probably benign Het
Angel2 G A 1: 190,673,187 (GRCm39) D255N probably benign Het
Apob T A 12: 8,039,113 (GRCm39) probably benign Het
Arfgef2 A T 2: 166,715,603 (GRCm39) R1349S probably damaging Het
Atp2b2 C T 6: 113,770,656 (GRCm39) V418I probably damaging Het
Birc6 C A 17: 74,930,741 (GRCm39) probably benign Het
Capn13 T A 17: 73,658,519 (GRCm39) Y183F probably damaging Het
Cngb1 A G 8: 95,987,266 (GRCm39) S352P probably damaging Het
Col6a3 A G 1: 90,741,273 (GRCm39) S720P probably damaging Het
Cpa4 C T 6: 30,579,657 (GRCm39) R155W probably damaging Het
Dapk1 A G 13: 60,908,914 (GRCm39) I1176V probably benign Het
Dnah17 T C 11: 117,949,132 (GRCm39) E2959G probably benign Het
Dnah7b T A 1: 46,252,520 (GRCm39) I1734N possibly damaging Het
Dnajb7 A G 15: 81,291,555 (GRCm39) Y261H probably benign Het
Dock2 T C 11: 34,579,392 (GRCm39) probably benign Het
Dyrk3 A T 1: 131,057,576 (GRCm39) V199E probably damaging Het
F2r G T 13: 95,740,994 (GRCm39) C180* probably null Het
F5 A G 1: 164,012,483 (GRCm39) S466G probably benign Het
Fbn2 A T 18: 58,235,445 (GRCm39) C677* probably null Het
Fbxo41 A G 6: 85,454,890 (GRCm39) S673P probably damaging Het
Fhad1 G T 4: 141,667,406 (GRCm39) H639N probably benign Het
Fmnl3 G C 15: 99,220,619 (GRCm39) probably benign Het
Foxa2 A G 2: 147,885,481 (GRCm39) S270P probably damaging Het
Fxyd7 C T 7: 30,746,793 (GRCm39) probably null Het
Gm5225 A G 17: 24,243,032 (GRCm39) D67G probably benign Het
Grik3 G A 4: 125,564,349 (GRCm39) E444K probably benign Het
Gsdma2 A G 11: 98,540,009 (GRCm39) K44E probably damaging Het
Haus1 T A 18: 77,849,770 (GRCm39) K130* probably null Het
Heg1 A G 16: 33,556,028 (GRCm39) probably benign Het
Hormad2 A G 11: 4,362,206 (GRCm39) probably benign Het
Hsd17b3 G A 13: 64,206,403 (GRCm39) R300C possibly damaging Het
Irf5 T C 6: 29,536,108 (GRCm39) F374S probably damaging Het
Itch A G 2: 155,059,903 (GRCm39) probably benign Het
Jade2 A T 11: 51,722,136 (GRCm39) L139Q probably damaging Het
Kif5c G A 2: 49,642,251 (GRCm39) probably benign Het
Lama1 T C 17: 68,083,918 (GRCm39) Y1387H probably benign Het
Larp4b A G 13: 9,220,724 (GRCm39) R658G probably damaging Het
Mcph1 C T 8: 18,838,264 (GRCm39) L729F probably benign Het
Me1 A T 9: 86,536,720 (GRCm39) N118K probably benign Het
Med13 A G 11: 86,210,723 (GRCm39) L473S probably damaging Het
Mgam T A 6: 40,635,921 (GRCm39) Y359N probably damaging Het
Morc2b A G 17: 33,356,015 (GRCm39) S586P probably damaging Het
Mthfr A G 4: 148,135,980 (GRCm39) D310G probably benign Het
Mtmr7 A T 8: 41,034,447 (GRCm39) probably benign Het
Mtus1 A G 8: 41,451,514 (GRCm39) probably benign Het
Mus81 G T 19: 5,536,552 (GRCm39) A138D probably damaging Het
Myom2 A T 8: 15,167,633 (GRCm39) I1073F probably damaging Het
Nhsl1 A T 10: 18,400,990 (GRCm39) K739* probably null Het
Nlrp4d T A 7: 10,108,818 (GRCm39) K762N probably benign Het
Nrap T C 19: 56,343,978 (GRCm39) Y724C probably damaging Het
Ogn A T 13: 49,774,514 (GRCm39) Y219F possibly damaging Het
Or6c212 T A 10: 129,558,846 (GRCm39) D189V probably damaging Het
Or8b56 T C 9: 38,739,860 (GRCm39) L291P probably damaging Het
Or8g30 A T 9: 39,230,160 (GRCm39) I250N probably damaging Het
Padi2 T C 4: 140,653,550 (GRCm39) V180A probably benign Het
Papss2 C T 19: 32,615,768 (GRCm39) R167* probably null Het
Pcbp2 T C 15: 102,382,670 (GRCm39) probably benign Het
Per1 T A 11: 68,992,706 (GRCm39) probably benign Het
Pik3ca T C 3: 32,514,094 (GRCm39) I860T probably damaging Het
Pkdrej G A 15: 85,701,746 (GRCm39) Q1397* probably null Het
Plce1 T C 19: 38,710,265 (GRCm39) V1133A probably benign Het
Pnma8a T G 7: 16,694,625 (GRCm39) V160G probably damaging Het
Prss12 T C 3: 123,276,423 (GRCm39) C351R probably damaging Het
Qprt A T 7: 126,708,269 (GRCm39) L54Q probably damaging Het
Raf1 C T 6: 115,603,344 (GRCm39) S165N probably damaging Het
Rere A G 4: 150,701,433 (GRCm39) N1271S probably benign Het
Rnasel T A 1: 153,630,258 (GRCm39) L258H probably damaging Het
Ryr2 T C 13: 11,724,807 (GRCm39) D2502G probably damaging Het
Ryr3 G A 2: 112,633,510 (GRCm39) S2081L probably damaging Het
Sc5d G T 9: 42,171,155 (GRCm39) Y11* probably null Het
Slc25a29 A C 12: 108,793,017 (GRCm39) L187R possibly damaging Het
Slc2a7 G A 4: 150,252,721 (GRCm39) V454M probably benign Het
Slco1b2 A T 6: 141,615,114 (GRCm39) T340S probably benign Het
Smarcc1 A G 9: 109,976,172 (GRCm39) N153S possibly damaging Het
Snx1 C A 9: 65,995,821 (GRCm39) E516* probably null Het
Sptlc2 T C 12: 87,403,454 (GRCm39) D115G probably benign Het
Stard9 A G 2: 120,464,736 (GRCm39) N67S probably damaging Het
Styxl2 A C 1: 165,927,270 (GRCm39) S781A probably benign Het
Swap70 G A 7: 109,872,489 (GRCm39) R368H probably benign Het
Tcaf3 T C 6: 42,568,284 (GRCm39) K691E probably benign Het
Tmco4 T C 4: 138,781,231 (GRCm39) F465S probably damaging Het
Tmem245 A G 4: 56,926,213 (GRCm39) S290P probably benign Het
Top2a T C 11: 98,894,416 (GRCm39) T972A probably benign Het
Tpr T A 1: 150,285,898 (GRCm39) S527R probably damaging Het
Traf2 T C 2: 25,409,621 (GRCm39) D443G probably damaging Het
Trim40 A T 17: 37,194,039 (GRCm39) probably null Het
Trim42 A T 9: 97,245,456 (GRCm39) I448N possibly damaging Het
Ttll9 G A 2: 152,825,054 (GRCm39) V78M probably damaging Het
Vav1 C T 17: 57,603,039 (GRCm39) L88F probably damaging Het
Vps13b A G 15: 35,423,301 (GRCm39) D207G probably damaging Het
Wdsub1 A G 2: 59,707,009 (GRCm39) probably null Het
Zfp799 A G 17: 33,040,009 (GRCm39) W85R possibly damaging Het
Other mutations in Zfp839
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Zfp839 APN 12 110,831,441 (GRCm39) critical splice donor site probably null
IGL00941:Zfp839 APN 12 110,827,382 (GRCm39) missense probably damaging 1.00
R0013:Zfp839 UTSW 12 110,834,820 (GRCm39) missense possibly damaging 0.66
R0013:Zfp839 UTSW 12 110,834,820 (GRCm39) missense possibly damaging 0.66
R0109:Zfp839 UTSW 12 110,827,308 (GRCm39) missense possibly damaging 0.92
R1219:Zfp839 UTSW 12 110,834,707 (GRCm39) missense possibly damaging 0.63
R1406:Zfp839 UTSW 12 110,832,744 (GRCm39) missense probably damaging 0.99
R1406:Zfp839 UTSW 12 110,832,744 (GRCm39) missense probably damaging 0.99
R1434:Zfp839 UTSW 12 110,827,333 (GRCm39) missense probably benign 0.08
R1653:Zfp839 UTSW 12 110,821,684 (GRCm39) missense probably benign 0.02
R1754:Zfp839 UTSW 12 110,821,891 (GRCm39) missense probably damaging 0.98
R2182:Zfp839 UTSW 12 110,834,772 (GRCm39) missense probably damaging 1.00
R3765:Zfp839 UTSW 12 110,821,597 (GRCm39) missense probably benign 0.22
R3981:Zfp839 UTSW 12 110,832,765 (GRCm39) missense probably damaging 0.97
R4756:Zfp839 UTSW 12 110,821,635 (GRCm39) missense possibly damaging 0.92
R5088:Zfp839 UTSW 12 110,834,610 (GRCm39) missense probably damaging 0.99
R5394:Zfp839 UTSW 12 110,822,020 (GRCm39) missense probably benign 0.05
R5619:Zfp839 UTSW 12 110,830,470 (GRCm39) missense probably damaging 1.00
R6856:Zfp839 UTSW 12 110,833,195 (GRCm39) nonsense probably null
R7661:Zfp839 UTSW 12 110,835,226 (GRCm39) missense probably benign 0.32
R7860:Zfp839 UTSW 12 110,822,060 (GRCm39) missense probably damaging 1.00
R8022:Zfp839 UTSW 12 110,821,532 (GRCm39) missense probably damaging 1.00
R8855:Zfp839 UTSW 12 110,834,848 (GRCm39) missense probably benign 0.06
R8866:Zfp839 UTSW 12 110,834,848 (GRCm39) missense probably benign 0.06
R8896:Zfp839 UTSW 12 110,835,277 (GRCm39) missense probably damaging 1.00
R9289:Zfp839 UTSW 12 110,834,878 (GRCm39) missense probably benign 0.04
R9606:Zfp839 UTSW 12 110,834,776 (GRCm39) missense probably benign
R9668:Zfp839 UTSW 12 110,822,280 (GRCm39) missense probably damaging 0.98
R9686:Zfp839 UTSW 12 110,821,932 (GRCm39) missense probably damaging 1.00
Z1177:Zfp839 UTSW 12 110,833,218 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTCCTTGTACCGCTATGCAGATG -3'
(R):5'- CAAGAATGGAATCCGAGCCGAGTC -3'

Sequencing Primer
(F):5'- TATGCAGATGGCCGCTTAC -3'
(R):5'- TCCACAGCGGTGTCATCTG -3'
Posted On 2013-04-11