Incidental Mutation 'R1853:Snd1'
ID 208324
Institutional Source Beutler Lab
Gene Symbol Snd1
Ensembl Gene ENSMUSG00000001424
Gene Name staphylococcal nuclease and tudor domain containing 1
Synonyms p100 co-activator, Tudor-SN
MMRRC Submission 039877-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock # R1853 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 28475139-28935162 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28545564 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 373 (I373N)
Ref Sequence ENSEMBL: ENSMUSP00000128737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000164915] [ENSMUST00000167201]
AlphaFold Q78PY7
Predicted Effect probably damaging
Transcript: ENSMUST00000001460
AA Change: I373N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424
AA Change: I373N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164915
SMART Domains Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 142 1.56e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167201
AA Change: I373N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424
AA Change: I373N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,875,559 V67A probably damaging Het
9530053A07Rik C T 7: 28,155,546 Q1866* probably null Het
Acadvl T C 11: 70,010,870 K554E probably damaging Het
Acap2 C T 16: 31,117,304 E322K probably damaging Het
Adam32 T C 8: 24,898,626 Y354C probably benign Het
Agl A T 3: 116,779,322 Y789* probably null Het
Aida A G 1: 183,306,445 T68A probably benign Het
Aldh3b3 T A 19: 3,965,822 L264Q probably damaging Het
Anks6 T C 4: 47,049,387 T173A probably benign Het
Ankzf1 A G 1: 75,198,128 probably null Het
Apob A T 12: 8,010,928 K3137* probably null Het
Arhgef16 C T 4: 154,291,106 V144I probably benign Het
Arhgef2 A T 3: 88,632,915 T107S possibly damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
BC035947 T C 1: 78,499,016 N293S possibly damaging Het
Bhmt C T 13: 93,625,335 V147M probably damaging Het
Ccdc112 A T 18: 46,285,700 H447Q probably benign Het
Cd274 T A 19: 29,380,482 N191K probably damaging Het
Ckmt1 C T 2: 121,360,650 T181I probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col28a1 T G 6: 8,014,574 I944L probably benign Het
Cttnbp2 T C 6: 18,408,602 T1007A probably benign Het
Cux2 G T 5: 121,869,121 P826T possibly damaging Het
Dap3 A T 3: 88,930,926 V86E probably damaging Het
Ddah1 A G 3: 145,891,549 I180M probably benign Het
Ddt T C 10: 75,773,304 E7G possibly damaging Het
Dhx57 A T 17: 80,274,879 Y432* probably null Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Ercc6 T A 14: 32,576,816 I1387N possibly damaging Het
Fancg T C 4: 43,009,727 E57G probably benign Het
Fkbp5 A T 17: 28,429,307 C103S possibly damaging Het
Gm14403 C A 2: 177,509,139 H293N probably damaging Het
Gm4353 G A 7: 116,083,569 P259L probably benign Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Hibch T C 1: 52,901,335 probably null Het
Impg2 T C 16: 56,260,277 S815P probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Kcnd3 A T 3: 105,459,752 T313S probably damaging Het
Kctd14 A T 7: 97,453,424 S38C possibly damaging Het
Kdm3b G T 18: 34,833,393 R1660L probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Klhl2 G A 8: 64,823,006 H82Y probably benign Het
Lama3 A T 18: 12,513,705 T1759S possibly damaging Het
Lamb1 T G 12: 31,318,272 C1134G probably damaging Het
Macf1 T C 4: 123,512,720 probably null Het
Mlph C T 1: 90,945,667 Q567* probably null Het
Mocos A C 18: 24,695,969 E777A probably damaging Het
Neil1 T A 9: 57,144,715 Q214L probably damaging Het
Nes A G 3: 87,975,807 T458A possibly damaging Het
Nlgn1 A T 3: 26,133,522 N71K possibly damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Nupl1 T C 14: 60,244,547 T123A possibly damaging Het
Oas1c A T 5: 120,807,995 V146E probably damaging Het
Oit3 C T 10: 59,441,622 probably null Het
Olfr361 A T 2: 37,085,220 F176Y probably damaging Het
Olfr726 A G 14: 50,084,120 L187P probably damaging Het
Osbp T C 19: 11,973,891 S267P possibly damaging Het
Pclo T A 5: 14,676,684 probably benign Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Pds5a A G 5: 65,624,029 V1036A possibly damaging Het
Pitx3 C T 19: 46,137,473 G4R probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Pole T G 5: 110,306,853 I984R possibly damaging Het
Ppil2 A C 16: 17,107,223 D28E probably benign Het
Psme2 T A 14: 55,588,479 I124F probably damaging Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Rnf165 T A 18: 77,462,975 S279C possibly damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Srrm2 A G 17: 23,820,525 T2144A probably damaging Het
Sst A G 16: 23,890,653 L31P probably damaging Het
Stab1 C T 14: 31,140,463 V2305M probably damaging Het
Stard9 T C 2: 120,688,751 I545T probably damaging Het
Tcaim T C 9: 122,826,206 W248R probably damaging Het
Tepsin A C 11: 120,098,636 F13C probably damaging Het
Terf1 T A 1: 15,818,938 L197* probably null Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Tmem63b G A 17: 45,661,297 H745Y possibly damaging Het
Trim40 A G 17: 36,889,078 L36P probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trio T C 15: 27,756,536 Y914C probably damaging Het
Vmn2r113 G A 17: 22,945,527 V135I probably benign Het
Vmn2r117 T A 17: 23,477,455 H326L probably damaging Het
Vmn2r28 A T 7: 5,481,247 C651* probably null Het
Xpnpep1 T C 19: 53,006,210 E329G probably benign Het
Xpo4 G A 14: 57,585,907 T1042M possibly damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zfp51 A T 17: 21,464,323 H400L probably damaging Het
Zfp518b A T 5: 38,673,407 F418L probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp672 T C 11: 58,316,964 H177R probably benign Het
Zfp692 C A 11: 58,309,979 P229T possibly damaging Het
Zswim4 A T 8: 84,224,200 C533S probably damaging Het
Other mutations in Snd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Snd1 APN 6 28512986 critical splice donor site probably null
IGL00940:Snd1 APN 6 28745175 intron probably benign
IGL01340:Snd1 APN 6 28883369 missense probably benign
IGL01892:Snd1 APN 6 28888124 critical splice donor site probably null
IGL02063:Snd1 APN 6 28526221 unclassified probably benign
IGL02134:Snd1 APN 6 28880279 missense possibly damaging 0.81
IGL02366:Snd1 APN 6 28707150 intron probably benign
PIT4677001:Snd1 UTSW 6 28880296 missense probably benign 0.01
R0039:Snd1 UTSW 6 28745210 missense probably damaging 1.00
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0463:Snd1 UTSW 6 28724956 missense probably benign 0.00
R0576:Snd1 UTSW 6 28886577 missense probably benign 0.31
R0709:Snd1 UTSW 6 28545470 splice site probably benign
R0959:Snd1 UTSW 6 28884971 missense probably benign 0.01
R1698:Snd1 UTSW 6 28888253 nonsense probably null
R2059:Snd1 UTSW 6 28745207 missense probably damaging 1.00
R2497:Snd1 UTSW 6 28888079 missense probably benign
R3832:Snd1 UTSW 6 28531404 splice site probably benign
R3833:Snd1 UTSW 6 28531404 splice site probably benign
R4643:Snd1 UTSW 6 28880249 missense probably benign 0.00
R4665:Snd1 UTSW 6 28707054 missense probably damaging 1.00
R4843:Snd1 UTSW 6 28668643 missense probably damaging 1.00
R4884:Snd1 UTSW 6 28526912 missense possibly damaging 0.94
R4959:Snd1 UTSW 6 28884251 nonsense probably null
R4973:Snd1 UTSW 6 28884251 nonsense probably null
R5065:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5066:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5067:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5131:Snd1 UTSW 6 28885050 missense probably damaging 0.99
R5172:Snd1 UTSW 6 28886616 missense possibly damaging 0.91
R5239:Snd1 UTSW 6 28545525 missense probably damaging 1.00
R5313:Snd1 UTSW 6 28668601 missense probably benign 0.15
R5395:Snd1 UTSW 6 28526184 missense probably damaging 0.99
R5938:Snd1 UTSW 6 28874859 critical splice acceptor site probably null
R6019:Snd1 UTSW 6 28880234 missense probably benign 0.00
R6248:Snd1 UTSW 6 28520235 nonsense probably null
R6337:Snd1 UTSW 6 28888289 missense probably damaging 1.00
R6810:Snd1 UTSW 6 28668610 missense probably benign 0.23
R6932:Snd1 UTSW 6 28626101 missense probably benign 0.42
R7469:Snd1 UTSW 6 28626127 missense probably damaging 1.00
R7485:Snd1 UTSW 6 28531450 missense probably benign 0.14
R7571:Snd1 UTSW 6 28526203 missense possibly damaging 0.81
R7866:Snd1 UTSW 6 28527725 missense probably damaging 1.00
R8178:Snd1 UTSW 6 28874976 missense possibly damaging 0.85
R8208:Snd1 UTSW 6 28526055 missense possibly damaging 0.86
R8526:Snd1 UTSW 6 28745254 missense probably benign 0.00
R8848:Snd1 UTSW 6 28874963 missense possibly damaging 0.72
R8854:Snd1 UTSW 6 28526969 missense probably benign 0.02
R9310:Snd1 UTSW 6 28795937 missense probably null 1.00
R9326:Snd1 UTSW 6 28795843 nonsense probably null
R9348:Snd1 UTSW 6 28745207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACTTTCATGTCTGATTGTGATG -3'
(R):5'- GATGCTTCCTGAGTGCTTACAG -3'

Sequencing Primer
(F):5'- ATGGGCCTGGCTCTTTGC -3'
(R):5'- GAATGACCCTCACAGGTTCATGTAG -3'
Posted On 2014-06-23