Incidental Mutation 'R1853:Neil1'
ID208339
Institutional Source Beutler Lab
Gene Symbol Neil1
Ensembl Gene ENSMUSG00000032298
Gene Namenei endonuclease VIII-like 1 (E. coli)
Synonyms2810450N13Rik
MMRRC Submission 039877-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R1853 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57142800-57148305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57144715 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 214 (Q214L)
Ref Sequence ENSEMBL: ENSMUSP00000139917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034836] [ENSMUST00000034842] [ENSMUST00000160147] [ENSMUST00000161182] [ENSMUST00000161663] [ENSMUST00000190245] [ENSMUST00000186410]
Predicted Effect probably benign
Transcript: ENSMUST00000034836
SMART Domains Protein: ENSMUSP00000034836
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 4.3e-89 PFAM
Alpha-mann_mid 516 593 1.37e-26 SMART
low complexity region 603 613 N/A INTRINSIC
Pfam:Glyco_hydro_38C 619 1029 1.3e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034842
AA Change: Q214L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034842
Gene: ENSMUSG00000032298
AA Change: Q214L

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159101
SMART Domains Protein: ENSMUSP00000124304
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 21 100 1.22e-32 SMART
low complexity region 110 120 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159843
Predicted Effect probably benign
Transcript: ENSMUST00000160147
SMART Domains Protein: ENSMUSP00000125478
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 2.8e-86 PFAM
Alpha-mann_mid 516 595 1.22e-32 SMART
low complexity region 605 615 N/A INTRINSIC
Pfam:Glyco_hydro_38C 621 1031 1.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160280
Predicted Effect probably benign
Transcript: ENSMUST00000160426
SMART Domains Protein: ENSMUSP00000124005
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 24 77 4.48e-1 SMART
low complexity region 87 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161182
SMART Domains Protein: ENSMUSP00000124020
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38 175 411 9.4e-67 PFAM
Alpha-mann_mid 417 496 1.22e-32 SMART
low complexity region 506 516 N/A INTRINSIC
Pfam:Glyco_hydro_38C 522 932 1.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161663
SMART Domains Protein: ENSMUSP00000124124
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 302 551 1.8e-81 PFAM
Alpha-mann_mid 557 636 1.22e-32 SMART
low complexity region 646 656 N/A INTRINSIC
Pfam:Glyco_hydro_38C 662 866 1.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190245
AA Change: Q214L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139917
Gene: ENSMUSG00000032298
AA Change: Q214L

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186410
AA Change: Q214L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141048
Gene: ENSMUSG00000032298
AA Change: Q214L

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162634
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nei endonuclease VIII-like gene family which encodes DNA glycosylases. The encoded enzyme participates in the DNA repair pathway by initiating base excision repair by removing damaged bases, primarily oxidized pyrimidines. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice develop severe obesity, dyslipidemia, fatty liver disease and tend to show hyperinsulinemia and increased mtDNA damage and deletions. Sporadic phenotypes include reduced subcutaneous fat, skin ulcers, joint inflammation, infertility,and tumors. Male heterozygotes become obese. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,875,559 V67A probably damaging Het
9530053A07Rik C T 7: 28,155,546 Q1866* probably null Het
Acadvl T C 11: 70,010,870 K554E probably damaging Het
Acap2 C T 16: 31,117,304 E322K probably damaging Het
Adam32 T C 8: 24,898,626 Y354C probably benign Het
Agl A T 3: 116,779,322 Y789* probably null Het
Aida A G 1: 183,306,445 T68A probably benign Het
Aldh3b3 T A 19: 3,965,822 L264Q probably damaging Het
Anks6 T C 4: 47,049,387 T173A probably benign Het
Ankzf1 A G 1: 75,198,128 probably null Het
Apob A T 12: 8,010,928 K3137* probably null Het
Arhgef16 C T 4: 154,291,106 V144I probably benign Het
Arhgef2 A T 3: 88,632,915 T107S possibly damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
BC035947 T C 1: 78,499,016 N293S possibly damaging Het
Bhmt C T 13: 93,625,335 V147M probably damaging Het
Ccdc112 A T 18: 46,285,700 H447Q probably benign Het
Cd274 T A 19: 29,380,482 N191K probably damaging Het
Ckmt1 C T 2: 121,360,650 T181I probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col28a1 T G 6: 8,014,574 I944L probably benign Het
Cttnbp2 T C 6: 18,408,602 T1007A probably benign Het
Cux2 G T 5: 121,869,121 P826T possibly damaging Het
Dap3 A T 3: 88,930,926 V86E probably damaging Het
Ddah1 A G 3: 145,891,549 I180M probably benign Het
Ddt T C 10: 75,773,304 E7G possibly damaging Het
Dhx57 A T 17: 80,274,879 Y432* probably null Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Ercc6 T A 14: 32,576,816 I1387N possibly damaging Het
Fancg T C 4: 43,009,727 E57G probably benign Het
Fkbp5 A T 17: 28,429,307 C103S possibly damaging Het
Gm14403 C A 2: 177,509,139 H293N probably damaging Het
Gm4353 G A 7: 116,083,569 P259L probably benign Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Hibch T C 1: 52,901,335 probably null Het
Impg2 T C 16: 56,260,277 S815P probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Kcnd3 A T 3: 105,459,752 T313S probably damaging Het
Kctd14 A T 7: 97,453,424 S38C possibly damaging Het
Kdm3b G T 18: 34,833,393 R1660L probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Klhl2 G A 8: 64,823,006 H82Y probably benign Het
Lama3 A T 18: 12,513,705 T1759S possibly damaging Het
Lamb1 T G 12: 31,318,272 C1134G probably damaging Het
Macf1 T C 4: 123,512,720 probably null Het
Mlph C T 1: 90,945,667 Q567* probably null Het
Mocos A C 18: 24,695,969 E777A probably damaging Het
Nes A G 3: 87,975,807 T458A possibly damaging Het
Nlgn1 A T 3: 26,133,522 N71K possibly damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Nupl1 T C 14: 60,244,547 T123A possibly damaging Het
Oas1c A T 5: 120,807,995 V146E probably damaging Het
Oit3 C T 10: 59,441,622 probably null Het
Olfr361 A T 2: 37,085,220 F176Y probably damaging Het
Olfr726 A G 14: 50,084,120 L187P probably damaging Het
Osbp T C 19: 11,973,891 S267P possibly damaging Het
Pclo T A 5: 14,676,684 probably benign Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Pds5a A G 5: 65,624,029 V1036A possibly damaging Het
Pitx3 C T 19: 46,137,473 G4R probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Pole T G 5: 110,306,853 I984R possibly damaging Het
Ppil2 A C 16: 17,107,223 D28E probably benign Het
Psme2 T A 14: 55,588,479 I124F probably damaging Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Rnf165 T A 18: 77,462,975 S279C possibly damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Snd1 T A 6: 28,545,564 I373N probably damaging Het
Srrm2 A G 17: 23,820,525 T2144A probably damaging Het
Sst A G 16: 23,890,653 L31P probably damaging Het
Stab1 C T 14: 31,140,463 V2305M probably damaging Het
Stard9 T C 2: 120,688,751 I545T probably damaging Het
Tcaim T C 9: 122,826,206 W248R probably damaging Het
Tepsin A C 11: 120,098,636 F13C probably damaging Het
Terf1 T A 1: 15,818,938 L197* probably null Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Tmem63b G A 17: 45,661,297 H745Y possibly damaging Het
Trim40 A G 17: 36,889,078 L36P probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trio T C 15: 27,756,536 Y914C probably damaging Het
Vmn2r113 G A 17: 22,945,527 V135I probably benign Het
Vmn2r117 T A 17: 23,477,455 H326L probably damaging Het
Vmn2r28 A T 7: 5,481,247 C651* probably null Het
Xpnpep1 T C 19: 53,006,210 E329G probably benign Het
Xpo4 G A 14: 57,585,907 T1042M possibly damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zfp51 A T 17: 21,464,323 H400L probably damaging Het
Zfp518b A T 5: 38,673,407 F418L probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp672 T C 11: 58,316,964 H177R probably benign Het
Zfp692 C A 11: 58,309,979 P229T possibly damaging Het
Zswim4 A T 8: 84,224,200 C533S probably damaging Het
Other mutations in Neil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Neil1 APN 9 57143977 critical splice donor site probably null
IGL02587:Neil1 APN 9 57144979 missense probably damaging 1.00
IGL03192:Neil1 APN 9 57143535 missense probably benign
R0138:Neil1 UTSW 9 57143746 splice site probably benign
R0348:Neil1 UTSW 9 57146781 splice site probably null
R0356:Neil1 UTSW 9 57146896 missense possibly damaging 0.57
R1280:Neil1 UTSW 9 57146901 missense probably damaging 1.00
R1835:Neil1 UTSW 9 57146604 missense probably damaging 1.00
R1942:Neil1 UTSW 9 57146607 missense probably benign 0.00
R2272:Neil1 UTSW 9 57146785 missense probably damaging 1.00
R3116:Neil1 UTSW 9 57146663 missense probably benign
R3608:Neil1 UTSW 9 57144201 missense probably damaging 1.00
R3713:Neil1 UTSW 9 57146970 missense probably damaging 1.00
R4883:Neil1 UTSW 9 57146922 missense probably damaging 1.00
R5744:Neil1 UTSW 9 57144201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGTCTGTTGAACAAACTC -3'
(R):5'- ACAGTGAGCAAGCATGTGTG -3'

Sequencing Primer
(F):5'- GGTCTGTTGAACAAACTCCCATC -3'
(R):5'- CTGGCTCTCCTGCTAGAGTG -3'
Posted On2014-06-23