Incidental Mutation 'R1853:Oit3'
ID 208343
Institutional Source Beutler Lab
Gene Symbol Oit3
Ensembl Gene ENSMUSG00000009654
Gene Name oncoprotein induced transcript 3
Synonyms EF-9
MMRRC Submission 039877-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.420) question?
Stock # R1853 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 59258782-59277601 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 59277444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009798]
AlphaFold Q8R4V5
Predicted Effect probably null
Transcript: ENSMUST00000009798
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 69,901,696 (GRCm39) K554E probably damaging Het
Acap2 C T 16: 30,936,122 (GRCm39) E322K probably damaging Het
Adam32 T C 8: 25,388,642 (GRCm39) Y354C probably benign Het
Agl A T 3: 116,572,971 (GRCm39) Y789* probably null Het
Aida A G 1: 183,087,380 (GRCm39) T68A probably benign Het
Aldh3b3 T A 19: 4,015,822 (GRCm39) L264Q probably damaging Het
Anks6 T C 4: 47,049,387 (GRCm39) T173A probably benign Het
Ankzf1 A G 1: 75,174,772 (GRCm39) probably null Het
Apob A T 12: 8,060,928 (GRCm39) K3137* probably null Het
Arhgef16 C T 4: 154,375,563 (GRCm39) V144I probably benign Het
Arhgef2 A T 3: 88,540,222 (GRCm39) T107S possibly damaging Het
Ark2c T A 18: 77,550,671 (GRCm39) S279C possibly damaging Het
Atad2 G A 15: 57,960,685 (GRCm39) P971L possibly damaging Het
Atp6ap1l T C 13: 91,031,707 (GRCm39) E325G probably damaging Het
BC035947 T C 1: 78,475,653 (GRCm39) N293S possibly damaging Het
Bhmt C T 13: 93,761,843 (GRCm39) V147M probably damaging Het
Ccdc112 A T 18: 46,418,767 (GRCm39) H447Q probably benign Het
Cd274 T A 19: 29,357,882 (GRCm39) N191K probably damaging Het
Ckmt1 C T 2: 121,191,131 (GRCm39) T181I probably damaging Het
Cnih3 C A 1: 181,282,186 (GRCm39) S140* probably null Het
Col28a1 T G 6: 8,014,574 (GRCm39) I944L probably benign Het
Cttnbp2 T C 6: 18,408,601 (GRCm39) T1007A probably benign Het
Cux2 G T 5: 122,007,184 (GRCm39) P826T possibly damaging Het
Cyren A G 6: 34,852,494 (GRCm39) V67A probably damaging Het
Dap3 A T 3: 88,838,233 (GRCm39) V86E probably damaging Het
Ddah1 A G 3: 145,597,304 (GRCm39) I180M probably benign Het
Ddt T C 10: 75,609,138 (GRCm39) E7G possibly damaging Het
Dhx57 A T 17: 80,582,308 (GRCm39) Y432* probably null Het
Dpp9 T C 17: 56,509,885 (GRCm39) I314V probably benign Het
Enpp2 C T 15: 54,709,219 (GRCm39) E803K probably damaging Het
Ercc6 T A 14: 32,298,773 (GRCm39) I1387N possibly damaging Het
Fancg T C 4: 43,009,727 (GRCm39) E57G probably benign Het
Fcgbpl1 C T 7: 27,854,971 (GRCm39) Q1866* probably null Het
Fkbp5 A T 17: 28,648,281 (GRCm39) C103S possibly damaging Het
Gm14403 C A 2: 177,200,932 (GRCm39) H293N probably damaging Het
Gm4353 G A 7: 115,682,804 (GRCm39) P259L probably benign Het
Gm4787 T A 12: 81,425,108 (GRCm39) H350L probably damaging Het
Hibch T C 1: 52,940,494 (GRCm39) probably null Het
Impg2 T C 16: 56,080,640 (GRCm39) S815P probably damaging Het
Ipo11 A T 13: 106,997,395 (GRCm39) I688K probably benign Het
Kcnd3 A T 3: 105,367,068 (GRCm39) T313S probably damaging Het
Kctd14 A T 7: 97,102,631 (GRCm39) S38C possibly damaging Het
Kdm3b G T 18: 34,966,446 (GRCm39) R1660L probably damaging Het
Kdr C T 5: 76,113,565 (GRCm39) G768S possibly damaging Het
Klhl2 G A 8: 65,275,658 (GRCm39) H82Y probably benign Het
Lama3 A T 18: 12,646,762 (GRCm39) T1759S possibly damaging Het
Lamb1 T G 12: 31,368,271 (GRCm39) C1134G probably damaging Het
Macf1 T C 4: 123,406,513 (GRCm39) probably null Het
Mlph C T 1: 90,873,389 (GRCm39) Q567* probably null Het
Mocos A C 18: 24,829,026 (GRCm39) E777A probably damaging Het
Neil1 T A 9: 57,051,999 (GRCm39) Q214L probably damaging Het
Nes A G 3: 87,883,114 (GRCm39) T458A possibly damaging Het
Nlgn1 A T 3: 26,187,671 (GRCm39) N71K possibly damaging Het
Nr4a1 T C 15: 101,169,645 (GRCm39) I305T probably benign Het
Nup58 T C 14: 60,481,996 (GRCm39) T123A possibly damaging Het
Oas1c A T 5: 120,946,060 (GRCm39) V146E probably damaging Het
Or12k8 A T 2: 36,975,232 (GRCm39) F176Y probably damaging Het
Or4k15c A G 14: 50,321,577 (GRCm39) L187P probably damaging Het
Osbp T C 19: 11,951,255 (GRCm39) S267P possibly damaging Het
Pclo T A 5: 14,726,698 (GRCm39) probably benign Het
Pde9a C T 17: 31,674,094 (GRCm39) P60S probably damaging Het
Pdia3 T C 2: 121,262,144 (GRCm39) I205T probably benign Het
Pdia4 A T 6: 47,790,161 (GRCm39) D26E unknown Het
Pds5a A G 5: 65,781,372 (GRCm39) V1036A possibly damaging Het
Pitx3 C T 19: 46,125,912 (GRCm39) G4R probably benign Het
Pnn T A 12: 59,118,399 (GRCm39) N327K probably damaging Het
Pole T G 5: 110,454,719 (GRCm39) I984R possibly damaging Het
Psme2 T A 14: 55,825,936 (GRCm39) I124F probably damaging Het
Pstpip2 T A 18: 77,959,499 (GRCm39) L198Q probably damaging Het
Siglece A G 7: 43,309,360 (GRCm39) F66S probably benign Het
Slc1a6 T A 10: 78,648,758 (GRCm39) V493E probably damaging Het
Snd1 T A 6: 28,545,563 (GRCm39) I373N probably damaging Het
Srrm2 A G 17: 24,039,499 (GRCm39) T2144A probably damaging Het
Sst A G 16: 23,709,403 (GRCm39) L31P probably damaging Het
Stab1 C T 14: 30,862,420 (GRCm39) V2305M probably damaging Het
Stard9 T C 2: 120,519,232 (GRCm39) I545T probably damaging Het
Tcaim T C 9: 122,655,271 (GRCm39) W248R probably damaging Het
Tepsin A C 11: 119,989,462 (GRCm39) F13C probably damaging Het
Terf1 T A 1: 15,889,162 (GRCm39) L197* probably null Het
Tiam2 C T 17: 3,465,410 (GRCm39) R380C probably damaging Het
Tmem63b G A 17: 45,972,223 (GRCm39) H745Y possibly damaging Het
Trim40 A G 17: 37,199,970 (GRCm39) L36P probably damaging Het
Trim72 A G 7: 127,608,254 (GRCm39) I251V probably benign Het
Trio T C 15: 27,756,622 (GRCm39) Y914C probably damaging Het
Vmn2r113 G A 17: 23,164,501 (GRCm39) V135I probably benign Het
Vmn2r117 T A 17: 23,696,429 (GRCm39) H326L probably damaging Het
Vmn2r28 A T 7: 5,484,246 (GRCm39) C651* probably null Het
Xpnpep1 T C 19: 52,994,641 (GRCm39) E329G probably benign Het
Xpo4 G A 14: 57,823,364 (GRCm39) T1042M possibly damaging Het
Ypel1 A C 16: 16,925,087 (GRCm39) D28E probably benign Het
Zdbf2 GAAAAA GAAAAAA 1: 63,344,701 (GRCm39) probably null Het
Zfp51 A T 17: 21,684,585 (GRCm39) H400L probably damaging Het
Zfp518b A T 5: 38,830,750 (GRCm39) F418L probably benign Het
Zfp54 T A 17: 21,654,404 (GRCm39) Y299* probably null Het
Zfp672 T C 11: 58,207,790 (GRCm39) H177R probably benign Het
Zfp692 C A 11: 58,200,805 (GRCm39) P229T possibly damaging Het
Zswim4 A T 8: 84,950,829 (GRCm39) C533S probably damaging Het
Other mutations in Oit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Oit3 APN 10 59,261,306 (GRCm39) unclassified probably benign
IGL01665:Oit3 APN 10 59,274,731 (GRCm39) missense probably damaging 1.00
IGL01839:Oit3 APN 10 59,265,318 (GRCm39) missense probably damaging 0.98
IGL02028:Oit3 APN 10 59,274,477 (GRCm39) missense probably damaging 0.98
PIT4585001:Oit3 UTSW 10 59,266,835 (GRCm39) missense possibly damaging 0.54
R0567:Oit3 UTSW 10 59,271,800 (GRCm39) missense probably damaging 0.99
R0781:Oit3 UTSW 10 59,264,016 (GRCm39) missense probably damaging 1.00
R1110:Oit3 UTSW 10 59,264,016 (GRCm39) missense probably damaging 1.00
R1563:Oit3 UTSW 10 59,263,896 (GRCm39) missense probably damaging 1.00
R1623:Oit3 UTSW 10 59,264,061 (GRCm39) missense probably damaging 0.99
R1693:Oit3 UTSW 10 59,261,239 (GRCm39) missense probably damaging 1.00
R1754:Oit3 UTSW 10 59,263,762 (GRCm39) splice site probably null
R2070:Oit3 UTSW 10 59,266,835 (GRCm39) missense probably benign 0.03
R2211:Oit3 UTSW 10 59,263,892 (GRCm39) missense probably damaging 1.00
R2516:Oit3 UTSW 10 59,277,507 (GRCm39) start gained probably benign
R2516:Oit3 UTSW 10 59,264,167 (GRCm39) missense probably damaging 1.00
R3103:Oit3 UTSW 10 59,274,713 (GRCm39) missense probably damaging 0.98
R4414:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4415:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4416:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4417:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4584:Oit3 UTSW 10 59,261,284 (GRCm39) missense probably damaging 1.00
R4734:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R4748:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R4749:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R5070:Oit3 UTSW 10 59,259,849 (GRCm39) missense probably damaging 1.00
R5521:Oit3 UTSW 10 59,271,736 (GRCm39) missense probably benign
R6326:Oit3 UTSW 10 59,264,061 (GRCm39) missense probably damaging 1.00
R6490:Oit3 UTSW 10 59,274,374 (GRCm39) missense possibly damaging 0.92
R6526:Oit3 UTSW 10 59,265,462 (GRCm39) missense probably damaging 1.00
R6766:Oit3 UTSW 10 59,274,534 (GRCm39) missense probably damaging 0.99
R6921:Oit3 UTSW 10 59,271,767 (GRCm39) missense probably damaging 0.99
R7129:Oit3 UTSW 10 59,264,166 (GRCm39) missense probably damaging 0.99
R7440:Oit3 UTSW 10 59,265,392 (GRCm39) missense probably damaging 0.99
R7495:Oit3 UTSW 10 59,259,765 (GRCm39) missense possibly damaging 0.74
R7512:Oit3 UTSW 10 59,274,716 (GRCm39) missense probably damaging 1.00
R7866:Oit3 UTSW 10 59,259,852 (GRCm39) missense probably benign 0.03
R8312:Oit3 UTSW 10 59,274,632 (GRCm39) missense probably benign 0.01
R8321:Oit3 UTSW 10 59,263,982 (GRCm39) missense probably benign 0.00
R8919:Oit3 UTSW 10 59,277,468 (GRCm39) missense unknown
R9131:Oit3 UTSW 10 59,271,751 (GRCm39) missense probably benign 0.01
R9457:Oit3 UTSW 10 59,277,505 (GRCm39) start codon destroyed unknown
R9478:Oit3 UTSW 10 59,274,464 (GRCm39) missense probably damaging 0.99
R9502:Oit3 UTSW 10 59,264,173 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGAAGTCCTAGCCACTC -3'
(R):5'- TCTTCCTAAGAGTCCAGAGGG -3'

Sequencing Primer
(F):5'- CACGAAACAAAAATTCTCTGGGTG -3'
(R):5'- GATATTCTCCCCTAAGTGCTTGAGAG -3'
Posted On 2014-06-23