Mutagenetix > Incidental Mutation

Incidental Mutation 'R0116:Vps13b'

20837

Institutional Source

Beutler Lab

Gene Symbol

Vps13b

Ensembl Gene

ENSMUSG00000037646

Gene Name

vacuolar protein sorting 13B

Synonyms

2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik

MMRRC Submission

038402-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0116 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

35371160-35931229 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35423155 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 207 (D207G)

Ref Sequence

ENSEMBL: ENSMUSP00000045490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048646]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000048646
AA Change: D207G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: D207G

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	2	120	1e-29	PFAM
low complexity region	128	137	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1007	1018	N/A	INTRINSIC
low complexity region	1876	1883	N/A	INTRINSIC
low complexity region	2042	2054	N/A	INTRINSIC
low complexity region	2414	2423	N/A	INTRINSIC
Pfam:SHR-BD	2601	2700	8.4e-10	PFAM
low complexity region	2954	2964	N/A	INTRINSIC
Pfam:VPS13_C	3539	3706	2.6e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227309

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228338

Meta Mutation Damage Score

0.5016

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.2%

Validation Efficiency

94% (95/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406C07Rik	A	T	9: 15,290,770	V152E	probably damaging	Het
Abca5	T	G	11: 110,276,505	E1495A	probably damaging	Het
Abcc12	G	A	8: 86,534,998	S668F	probably benign	Het
Adgrl4	A	T	3: 151,517,610	T608S	probably benign	Het
Angel2	G	A	1: 190,940,990	D255N	probably benign	Het
Apob	T	A	12: 7,989,113		probably benign	Het
Arfgef2	A	T	2: 166,873,683	R1349S	probably damaging	Het
Atp2b2	C	T	6: 113,793,695	V418I	probably damaging	Het
Birc6	C	A	17: 74,623,746		probably benign	Het
Capn13	T	A	17: 73,351,524	Y183F	probably damaging	Het
Cngb1	A	G	8: 95,260,638	S352P	probably damaging	Het
Col6a3	A	G	1: 90,813,551	S720P	probably damaging	Het
Cpa4	C	T	6: 30,579,658	R155W	probably damaging	Het
Dapk1	A	G	13: 60,761,100	I1176V	probably benign	Het
Dnah17	T	C	11: 118,058,306	E2959G	probably benign	Het
Dnah7b	T	A	1: 46,213,360	I1734N	possibly damaging	Het
Dnajb7	A	G	15: 81,407,354	Y261H	probably benign	Het
Dock2	T	C	11: 34,688,565		probably benign	Het
Dusp27	A	C	1: 166,099,701	S781A	probably benign	Het
Dyrk3	A	T	1: 131,129,839	V199E	probably damaging	Het
F2r	G	T	13: 95,604,486	C180*	probably null	Het
F5	A	G	1: 164,184,914	S466G	probably benign	Het
Fbn2	A	T	18: 58,102,373	C677*	probably null	Het
Fbxo41	A	G	6: 85,477,908	S673P	probably damaging	Het
Fhad1	G	T	4: 141,940,095	H639N	probably benign	Het
Fmnl3	G	C	15: 99,322,738		probably benign	Het
Foxa2	A	G	2: 148,043,561	S270P	probably damaging	Het
Fxyd7	C	T	7: 31,047,368		probably null	Het
Gm5225	A	G	17: 24,024,058	D67G	probably benign	Het
Grik3	G	A	4: 125,670,556	E444K	probably benign	Het
Gsdma2	A	G	11: 98,649,183	K44E	probably damaging	Het
Haus1	T	A	18: 77,762,070	K130*	probably null	Het
Heg1	A	G	16: 33,735,658		probably benign	Het
Hormad2	A	G	11: 4,412,206		probably benign	Het
Hsd17b3	G	A	13: 64,058,589	R300C	possibly damaging	Het
Irf5	T	C	6: 29,536,109	F374S	probably damaging	Het
Itch	A	G	2: 155,217,983		probably benign	Het
Jade2	A	T	11: 51,831,309	L139Q	probably damaging	Het
Kif5c	G	A	2: 49,752,239		probably benign	Het
Lama1	T	C	17: 67,776,923	Y1387H	probably benign	Het
Larp4b	A	G	13: 9,170,688	R658G	probably damaging	Het
Mcph1	C	T	8: 18,788,248	L729F	probably benign	Het
Me1	A	T	9: 86,654,667	N118K	probably benign	Het
Med13	A	G	11: 86,319,897	L473S	probably damaging	Het
Mgam	T	A	6: 40,658,987	Y359N	probably damaging	Het
Morc2b	A	G	17: 33,137,041	S586P	probably damaging	Het
Mthfr	A	G	4: 148,051,523	D310G	probably benign	Het
Mtmr7	A	T	8: 40,581,405		probably benign	Het
Mtus1	A	G	8: 40,998,477		probably benign	Het
Mus81	G	T	19: 5,486,524	A138D	probably damaging	Het
Myom2	A	T	8: 15,117,633	I1073F	probably damaging	Het
Nhsl1	A	T	10: 18,525,242	K739*	probably null	Het
Nlrp4d	T	A	7: 10,374,891	K762N	probably benign	Het
Nrap	T	C	19: 56,355,546	Y724C	probably damaging	Het
Ogn	A	T	13: 49,621,038	Y219F	possibly damaging	Het
Olfr805	T	A	10: 129,722,977	D189V	probably damaging	Het
Olfr923	T	C	9: 38,828,564	L291P	probably damaging	Het
Olfr948	A	T	9: 39,318,864	I250N	probably damaging	Het
Padi2	T	C	4: 140,926,239	V180A	probably benign	Het
Papss2	C	T	19: 32,638,368	R167*	probably null	Het
Pcbp2	T	C	15: 102,474,235		probably benign	Het
Per1	T	A	11: 69,101,880		probably benign	Het
Pik3ca	T	C	3: 32,459,945	I860T	probably damaging	Het
Pkdrej	G	A	15: 85,817,545	Q1397*	probably null	Het
Plce1	T	C	19: 38,721,821	V1133A	probably benign	Het
Pnmal1	T	G	7: 16,960,700	V160G	probably damaging	Het
Prss12	T	C	3: 123,482,774	C351R	probably damaging	Het
Qprt	A	T	7: 127,109,097	L54Q	probably damaging	Het
Raf1	C	T	6: 115,626,383	S165N	probably damaging	Het
Rere	A	G	4: 150,616,976	N1271S	probably benign	Het
Rnasel	T	A	1: 153,754,512	L258H	probably damaging	Het
Ryr2	T	C	13: 11,709,921	D2502G	probably damaging	Het
Ryr3	G	A	2: 112,803,165	S2081L	probably damaging	Het
Sc5d	G	T	9: 42,259,859	Y11*	probably null	Het
Slc25a29	A	C	12: 108,827,091	L187R	possibly damaging	Het
Slc2a7	G	A	4: 150,168,264	V454M	probably benign	Het
Slco1b2	A	T	6: 141,669,388	T340S	probably benign	Het
Smarcc1	A	G	9: 110,147,104	N153S	possibly damaging	Het
Snx1	C	A	9: 66,088,539	E516*	probably null	Het
Sptlc2	T	C	12: 87,356,680	D115G	probably benign	Het
Stard9	A	G	2: 120,634,255	N67S	probably damaging	Het
Swap70	G	A	7: 110,273,282	R368H	probably benign	Het
Tcaf3	T	C	6: 42,591,350	K691E	probably benign	Het
Tmco4	T	C	4: 139,053,920	F465S	probably damaging	Het
Tmem245	A	G	4: 56,926,213	S290P	probably benign	Het
Top2a	T	C	11: 99,003,590	T972A	probably benign	Het
Tpr	T	A	1: 150,410,147	S527R	probably damaging	Het
Traf2	T	C	2: 25,519,609	D443G	probably damaging	Het
Trim40	A	T	17: 36,883,147		probably null	Het
Trim42	A	T	9: 97,363,403	I448N	possibly damaging	Het
Ttll9	G	A	2: 152,983,134	V78M	probably damaging	Het
Vav1	C	T	17: 57,296,039	L88F	probably damaging	Het
Wdsub1	A	G	2: 59,876,665		probably null	Het
Zfp799	A	G	17: 32,821,035	W85R	possibly damaging	Het
Zfp839	A	T	12: 110,858,769		probably benign	Het

Other mutations in Vps13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Vps13b	APN	15	35926226	missense	possibly damaging	0.52
IGL00513:Vps13b	APN	15	35793884	missense	probably damaging	1.00
IGL00516:Vps13b	APN	15	35640557	missense	probably damaging	1.00
IGL00640:Vps13b	APN	15	35417577	missense	probably benign
IGL00753:Vps13b	APN	15	35372031	missense	probably damaging	0.99
IGL00784:Vps13b	APN	15	35846900	missense	probably damaging	1.00
IGL01138:Vps13b	APN	15	35446770	splice site	probably benign
IGL01349:Vps13b	APN	15	35793945	missense	probably benign	0.00
IGL01403:Vps13b	APN	15	35709479	missense	probably benign	0.00
IGL01535:Vps13b	APN	15	35454957	missense	possibly damaging	0.67
IGL01571:Vps13b	APN	15	35877489	splice site	probably benign
IGL01642:Vps13b	APN	15	35792072	missense	probably benign	0.43
IGL01658:Vps13b	APN	15	35671333	missense	probably damaging	0.99
IGL01759:Vps13b	APN	15	35878789	missense	probably damaging	1.00
IGL01763:Vps13b	APN	15	35709799	missense	possibly damaging	0.72
IGL01906:Vps13b	APN	15	35639847	splice site	probably benign
IGL01982:Vps13b	APN	15	35438904	nonsense	probably null
IGL01997:Vps13b	APN	15	35709224	missense	probably damaging	1.00
IGL02041:Vps13b	APN	15	35423245	missense	probably damaging	0.98
IGL02073:Vps13b	APN	15	35875586	missense	possibly damaging	0.52
IGL02077:Vps13b	APN	15	35910613	missense	possibly damaging	0.68
IGL02141:Vps13b	APN	15	35572081	missense	probably benign	0.09
IGL02146:Vps13b	APN	15	35646333	missense	probably benign	0.36
IGL02197:Vps13b	APN	15	35930056	missense	probably benign	0.02
IGL02311:Vps13b	APN	15	35709514	missense	probably benign	0.08
IGL02466:Vps13b	APN	15	35770741	missense	possibly damaging	0.86
IGL02506:Vps13b	APN	15	35917162	missense	probably damaging	1.00
IGL02550:Vps13b	APN	15	35572096	missense	probably benign
IGL02553:Vps13b	APN	15	35646301	missense	probably benign	0.00
IGL02674:Vps13b	APN	15	35639958	missense	probably benign	0.41
IGL02690:Vps13b	APN	15	35917142	missense	probably damaging	1.00
IGL02731:Vps13b	APN	15	35917128	missense	probably benign	0.00
IGL02739:Vps13b	APN	15	35879900	missense	probably damaging	1.00
IGL02868:Vps13b	APN	15	35884519	missense	probably benign	0.03
IGL03081:Vps13b	APN	15	35875820	missense	probably damaging	0.97
IGL03178:Vps13b	APN	15	35869300	missense	probably damaging	1.00
IGL03343:Vps13b	APN	15	35917170	missense	possibly damaging	0.76
IGL03407:Vps13b	APN	15	35639866	missense	possibly damaging	0.95
IGL03410:Vps13b	APN	15	35910340	missense	probably benign
omlette	UTSW	15	35671400	missense	probably benign	0.13
swiss	UTSW	15	35709673	missense	possibly damaging	0.80
FR4449:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4548:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4737:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4976:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
LCD18:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
PIT4531001:Vps13b	UTSW	15	35878825	missense	probably damaging	1.00
PIT4581001:Vps13b	UTSW	15	35534263	missense	probably damaging	1.00
PIT4618001:Vps13b	UTSW	15	35709240	missense	probably damaging	1.00
R0026:Vps13b	UTSW	15	35923301	missense	possibly damaging	0.62
R0026:Vps13b	UTSW	15	35923301	missense	possibly damaging	0.62
R0108:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0109:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0109:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0123:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0124:Vps13b	UTSW	15	35576528	critical splice donor site	probably null
R0134:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0137:Vps13b	UTSW	15	35926219	missense	probably benign	0.06
R0195:Vps13b	UTSW	15	35471899	missense	probably benign	0.00
R0225:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0320:Vps13b	UTSW	15	35674828	missense	probably damaging	0.98
R0333:Vps13b	UTSW	15	35879803	missense	probably damaging	1.00
R0336:Vps13b	UTSW	15	35455133	nonsense	probably null
R0463:Vps13b	UTSW	15	35597409	missense	probably damaging	0.98
R0466:Vps13b	UTSW	15	35445602	nonsense	probably null
R0472:Vps13b	UTSW	15	35417633	critical splice donor site	probably null
R0523:Vps13b	UTSW	15	35472050	missense	probably benign	0.20
R0602:Vps13b	UTSW	15	35422368	missense	probably damaging	1.00
R0612:Vps13b	UTSW	15	35623657	missense	probably benign	0.12
R0627:Vps13b	UTSW	15	35371999	nonsense	probably null
R0679:Vps13b	UTSW	15	35709703	missense	possibly damaging	0.73
R0742:Vps13b	UTSW	15	35794361	missense	probably benign	0.22
R1053:Vps13b	UTSW	15	35652363	missense	probably damaging	1.00
R1355:Vps13b	UTSW	15	35422454	missense	probably damaging	1.00
R1386:Vps13b	UTSW	15	35923312	missense	probably damaging	0.99
R1403:Vps13b	UTSW	15	35709122	splice site	probably benign
R1453:Vps13b	UTSW	15	35422444	missense	probably damaging	0.97
R1464:Vps13b	UTSW	15	35709484	missense	probably benign	0.14
R1464:Vps13b	UTSW	15	35709484	missense	probably benign	0.14
R1511:Vps13b	UTSW	15	35839975	missense	probably damaging	0.99
R1511:Vps13b	UTSW	15	35841573	missense	probably benign	0.00
R1513:Vps13b	UTSW	15	35438730	nonsense	probably null
R1536:Vps13b	UTSW	15	35875566	missense	probably damaging	0.98
R1537:Vps13b	UTSW	15	35792181	missense	possibly damaging	0.62
R1558:Vps13b	UTSW	15	35534319	missense	probably damaging	1.00
R1601:Vps13b	UTSW	15	35642436	missense	probably benign	0.11
R1653:Vps13b	UTSW	15	35607272	nonsense	probably null
R1695:Vps13b	UTSW	15	35576521	missense	probably benign	0.05
R1760:Vps13b	UTSW	15	35884619	missense	possibly damaging	0.54
R1785:Vps13b	UTSW	15	35879791	missense	probably damaging	1.00
R1786:Vps13b	UTSW	15	35879791	missense	probably damaging	1.00
R1803:Vps13b	UTSW	15	35430205	nonsense	probably null
R1804:Vps13b	UTSW	15	35917137	missense	probably damaging	1.00
R1808:Vps13b	UTSW	15	35792059	missense	probably benign	0.00
R1817:Vps13b	UTSW	15	35910642	missense	possibly damaging	0.86
R1818:Vps13b	UTSW	15	35877577	missense	probably benign	0.00
R1836:Vps13b	UTSW	15	35910232	missense	probably damaging	0.99
R1850:Vps13b	UTSW	15	35674959	splice site	probably benign
R1884:Vps13b	UTSW	15	35430291	splice site	probably benign
R1938:Vps13b	UTSW	15	35709507	missense	probably damaging	1.00
R1955:Vps13b	UTSW	15	35925408	critical splice donor site	probably null
R1956:Vps13b	UTSW	15	35869407	missense	probably damaging	1.00
R1958:Vps13b	UTSW	15	35878689	missense	probably damaging	0.99
R2013:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2014:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2015:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2038:Vps13b	UTSW	15	35884741	missense	probably damaging	1.00
R2058:Vps13b	UTSW	15	35841447	missense	probably damaging	1.00
R2082:Vps13b	UTSW	15	35910746	missense	possibly damaging	0.70
R2087:Vps13b	UTSW	15	35597493	missense	probably damaging	0.99
R2124:Vps13b	UTSW	15	35646080	missense	probably benign	0.08
R2130:Vps13b	UTSW	15	35671400	missense	probably benign	0.13
R2168:Vps13b	UTSW	15	35792188	missense	probably damaging	1.00
R2168:Vps13b	UTSW	15	35792189	missense	probably damaging	1.00
R2171:Vps13b	UTSW	15	35887197	missense	probably benign	0.44
R2221:Vps13b	UTSW	15	35884597	missense	probably benign
R2263:Vps13b	UTSW	15	35646181	missense	probably benign	0.02
R2289:Vps13b	UTSW	15	35572105	missense	probably damaging	1.00
R2316:Vps13b	UTSW	15	35674899	nonsense	probably null
R2351:Vps13b	UTSW	15	35869311	missense	probably damaging	1.00
R2512:Vps13b	UTSW	15	35884555	missense	probably benign	0.35
R3054:Vps13b	UTSW	15	35646361	missense	probably damaging	0.99
R3055:Vps13b	UTSW	15	35646361	missense	probably damaging	0.99
R3196:Vps13b	UTSW	15	35869395	missense	probably damaging	1.00
R3236:Vps13b	UTSW	15	35910304	missense	probably benign	0.40
R3404:Vps13b	UTSW	15	35926054	missense	probably damaging	1.00
R3722:Vps13b	UTSW	15	35671382	missense	probably damaging	0.99
R4077:Vps13b	UTSW	15	35455128	missense	probably damaging	0.99
R4153:Vps13b	UTSW	15	35792027	splice site	probably null
R4224:Vps13b	UTSW	15	35876419	missense	probably damaging	0.99
R4408:Vps13b	UTSW	15	35709294	missense	probably damaging	0.98
R4431:Vps13b	UTSW	15	35770753	missense	probably damaging	1.00
R4449:Vps13b	UTSW	15	35876793	missense	possibly damaging	0.86
R4508:Vps13b	UTSW	15	35709673	missense	possibly damaging	0.80
R4631:Vps13b	UTSW	15	35646132	missense	possibly damaging	0.95
R4655:Vps13b	UTSW	15	35770689	missense	probably benign
R4666:Vps13b	UTSW	15	35640544	missense	probably benign	0.13
R4684:Vps13b	UTSW	15	35646178	missense	probably damaging	0.98
R4684:Vps13b	UTSW	15	35841341	missense	probably benign
R4684:Vps13b	UTSW	15	35879821	missense	probably benign
R4721:Vps13b	UTSW	15	35910718	nonsense	probably null
R4771:Vps13b	UTSW	15	35910800	missense	probably damaging	1.00
R4830:Vps13b	UTSW	15	35452224	missense	possibly damaging	0.94
R4835:Vps13b	UTSW	15	35869372	missense	probably damaging	1.00
R4835:Vps13b	UTSW	15	35910293	missense	probably benign
R4857:Vps13b	UTSW	15	35456654	missense	probably benign	0.01
R4891:Vps13b	UTSW	15	35640515	splice site	probably null
R5095:Vps13b	UTSW	15	35923202	missense	probably damaging	1.00
R5110:Vps13b	UTSW	15	35770809	missense	probably damaging	0.99
R5147:Vps13b	UTSW	15	35456678	missense	probably benign	0.32
R5153:Vps13b	UTSW	15	35422453	missense	probably damaging	0.99
R5257:Vps13b	UTSW	15	35794421	missense	possibly damaging	0.75
R5258:Vps13b	UTSW	15	35794421	missense	possibly damaging	0.75
R5296:Vps13b	UTSW	15	35876413	missense	probably damaging	1.00
R5386:Vps13b	UTSW	15	35640528	critical splice acceptor site	probably null
R5396:Vps13b	UTSW	15	35886948	missense	probably damaging	0.99
R5412:Vps13b	UTSW	15	35533385	missense	probably damaging	1.00
R5488:Vps13b	UTSW	15	35770542	missense	probably benign
R5489:Vps13b	UTSW	15	35770542	missense	probably benign
R5503:Vps13b	UTSW	15	35452166	missense	probably damaging	0.97
R5575:Vps13b	UTSW	15	35929919	missense	probably damaging	1.00
R5781:Vps13b	UTSW	15	35794035	missense	probably damaging	0.97
R5872:Vps13b	UTSW	15	35869351	missense	possibly damaging	0.56
R5876:Vps13b	UTSW	15	35917061	missense	probably damaging	0.99
R5994:Vps13b	UTSW	15	35875772	missense	probably damaging	1.00
R6031:Vps13b	UTSW	15	35471968	missense	probably damaging	1.00
R6031:Vps13b	UTSW	15	35471968	missense	probably damaging	1.00
R6045:Vps13b	UTSW	15	35671316	missense	probably damaging	0.99
R6143:Vps13b	UTSW	15	35668738	missense	probably damaging	0.99
R6147:Vps13b	UTSW	15	35930031	missense	probably benign	0.16
R6218:Vps13b	UTSW	15	35770464	missense	probably benign	0.00
R6447:Vps13b	UTSW	15	35572126	missense	probably benign	0.02
R6555:Vps13b	UTSW	15	35846847	missense	probably damaging	1.00
R6578:Vps13b	UTSW	15	35446101	missense	probably damaging	0.99
R6640:Vps13b	UTSW	15	35617696	missense	possibly damaging	0.93
R6645:Vps13b	UTSW	15	35910305	missense	probably benign	0.25
R6711:Vps13b	UTSW	15	35887249	missense	probably damaging	1.00
R6727:Vps13b	UTSW	15	35770683	missense	probably benign	0.19
R6737:Vps13b	UTSW	15	35910611	missense	probably damaging	1.00
R6844:Vps13b	UTSW	15	35877590	missense	probably benign	0.06
R6849:Vps13b	UTSW	15	35905309	missense	probably damaging	1.00
R6861:Vps13b	UTSW	15	35576395	missense	probably damaging	0.99
R6938:Vps13b	UTSW	15	35423198	missense	probably damaging	0.99
R6943:Vps13b	UTSW	15	35448689	missense	possibly damaging	0.95
R6989:Vps13b	UTSW	15	35448581	missense	probably benign	0.02
R7092:Vps13b	UTSW	15	35640634	missense	probably damaging	1.00
R7232:Vps13b	UTSW	15	35877557	missense	probably damaging	1.00
R7307:Vps13b	UTSW	15	35841545	missense	probably benign
R7400:Vps13b	UTSW	15	35378900	missense	probably damaging	1.00
R7414:Vps13b	UTSW	15	35910827	missense	probably damaging	1.00
R7497:Vps13b	UTSW	15	35876697	missense	probably benign	0.38
R7500:Vps13b	UTSW	15	35910524	missense	possibly damaging	0.74
R7603:Vps13b	UTSW	15	35576439	missense	probably damaging	0.98
R7605:Vps13b	UTSW	15	35770646	missense	probably damaging	0.97
R7849:Vps13b	UTSW	15	35423232	missense	probably damaging	0.99
R7984:Vps13b	UTSW	15	35879913	missense	probably benign
R8094:Vps13b	UTSW	15	35668906	critical splice donor site	probably null
R8097:Vps13b	UTSW	15	35709346	missense	probably benign	0.38
R8131:Vps13b	UTSW	15	35372109	critical splice donor site	probably null
R8139:Vps13b	UTSW	15	35607272	nonsense	probably null
R8174:Vps13b	UTSW	15	35709310	nonsense	probably null
R8225:Vps13b	UTSW	15	35794382	missense	probably damaging	0.99
R8239:Vps13b	UTSW	15	35597404	missense	probably damaging	1.00
R8244:Vps13b	UTSW	15	35917203	missense	probably damaging	1.00
R8303:Vps13b	UTSW	15	35639917	missense	probably damaging	1.00
R8311:Vps13b	UTSW	15	35886954	missense	probably benign	0.37
R8443:Vps13b	UTSW	15	35455100	missense	probably benign
R8494:Vps13b	UTSW	15	35422448	missense	probably damaging	0.99
R8499:Vps13b	UTSW	15	35841320	missense	probably damaging	1.00
R8506:Vps13b	UTSW	15	35446745	missense	probably benign	0.31
R8559:Vps13b	UTSW	15	35876642	missense	probably damaging	1.00
R8686:Vps13b	UTSW	15	35925389	missense	probably damaging	0.99
R8782:Vps13b	UTSW	15	35422337	missense	possibly damaging	0.93
R8806:Vps13b	UTSW	15	35472066	critical splice donor site	probably benign
R8824:Vps13b	UTSW	15	35533299	missense	probably damaging	0.99
R9024:Vps13b	UTSW	15	35923324	missense	probably damaging	0.97
R9038:Vps13b	UTSW	15	35875785	missense	possibly damaging	0.70
R9054:Vps13b	UTSW	15	35422391	missense	probably damaging	1.00
R9091:Vps13b	UTSW	15	35770773	missense	probably benign	0.13
R9129:Vps13b	UTSW	15	35448647	missense	probably damaging	1.00
R9214:Vps13b	UTSW	15	35623746	missense	probably damaging	0.99
R9237:Vps13b	UTSW	15	35841333	missense	probably damaging	1.00
R9256:Vps13b	UTSW	15	35623779	missense	possibly damaging	0.95
R9270:Vps13b	UTSW	15	35770773	missense	probably benign	0.13
R9279:Vps13b	UTSW	15	35572144	missense	probably damaging	0.97
R9291:Vps13b	UTSW	15	35846913	missense	probably damaging	1.00
R9342:Vps13b	UTSW	15	35455054	missense	possibly damaging	0.94
R9404:Vps13b	UTSW	15	35876419	missense	probably damaging	1.00
R9488:Vps13b	UTSW	15	35447734	missense	possibly damaging	0.77
R9509:Vps13b	UTSW	15	35841311	missense	possibly damaging	0.79
R9610:Vps13b	UTSW	15	35642409	missense	possibly damaging	0.85
R9611:Vps13b	UTSW	15	35642409	missense	possibly damaging	0.85
R9658:Vps13b	UTSW	15	35623628	missense	probably benign	0.00
R9674:Vps13b	UTSW	15	35607234	missense	probably damaging	0.98
R9696:Vps13b	UTSW	15	35674887	missense	possibly damaging	0.56
R9767:Vps13b	UTSW	15	35910257	missense	probably damaging	1.00
R9797:Vps13b	UTSW	15	35674876	missense	probably damaging	1.00
RF020:Vps13b	UTSW	15	35925406	missense	probably null	1.00
X0026:Vps13b	UTSW	15	35910646	missense	probably damaging	1.00
X0028:Vps13b	UTSW	15	35709431	missense	probably benign	0.00
Z1177:Vps13b	UTSW	15	35668885	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCCTGCTTTCATTTGTAGGAGAGG -3'
(R):5'- GGACTAAAATACAGACTGCTGCTGTGC -3'

Sequencing Primer
(F):5'- CCTTTTTGGCTCACAGTGGTTT -3'
(R):5'- TTGCAGAAAAGGTTGCCTCC -3'

Posted On

2013-04-11