Incidental Mutation 'R0086:Olfr1224-ps1'
ID208398
Institutional Source Beutler Lab
Gene Symbol Olfr1224-ps1
Ensembl Gene ENSMUSG00000075099
Gene Nameolfactory receptor 1224, pseudogene 1
SynonymsGA_x6K02T2Q125-50635980-50635046, MOR233-15
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89155336-89164091 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89156476 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 233 (R233H)
Ref Sequence ENSEMBL: ENSMUSP00000148938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099792] [ENSMUST00000099793] [ENSMUST00000216833] [ENSMUST00000216976] [ENSMUST00000217342]
Predicted Effect probably benign
Transcript: ENSMUST00000099792
AA Change: R233H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097380
Gene: ENSMUSG00000075099
AA Change: R233H

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-48 PFAM
Pfam:7tm_1 39 287 9.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099793
AA Change: R233H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097381
Gene: ENSMUSG00000075099
AA Change: R233H

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2e-26 PFAM
Pfam:7tm_4 138 283 5.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214069
Predicted Effect probably benign
Transcript: ENSMUST00000216833
AA Change: R233H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216913
Predicted Effect probably benign
Transcript: ENSMUST00000216976
AA Change: R233H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000217342
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Olfr1224-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Olfr1224-ps1 APN 2 89156917 missense probably benign 0.01
IGL02561:Olfr1224-ps1 APN 2 89157141 missense possibly damaging 0.94
R0096:Olfr1224-ps1 UTSW 2 89156296 missense probably benign 0.03
R0096:Olfr1224-ps1 UTSW 2 89156296 missense probably benign 0.03
R0783:Olfr1224-ps1 UTSW 2 89156891 missense probably benign 0.30
R1920:Olfr1224-ps1 UTSW 2 89156581 missense probably benign 0.44
R1921:Olfr1224-ps1 UTSW 2 89156581 missense probably benign 0.44
R2033:Olfr1224-ps1 UTSW 2 89157154 missense probably damaging 0.96
R3500:Olfr1224-ps1 UTSW 2 89157059 missense probably damaging 1.00
R5044:Olfr1224-ps1 UTSW 2 89156939 nonsense probably null
R5140:Olfr1224-ps1 UTSW 2 89157107 missense probably benign 0.12
R5253:Olfr1224-ps1 UTSW 2 89156457 nonsense probably null
R6338:Olfr1224-ps1 UTSW 2 89156371 missense probably damaging 1.00
R6431:Olfr1224-ps1 UTSW 2 89157161 missense probably damaging 1.00
R6904:Olfr1224-ps1 UTSW 2 89156813 missense possibly damaging 0.57
R7259:Olfr1224-ps1 UTSW 2 89156510 missense probably benign 0.03
R7820:Olfr1224-ps1 UTSW 2 89156248 missense probably benign 0.08
Z1176:Olfr1224-ps1 UTSW 2 89156467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGTTGATGGTATGGGAAAGGGT -3'
(R):5'- CCCATTACTAAAGCTTGCCTGCACC -3'

Sequencing Primer
(F):5'- tctattacaaattgagccatttccc -3'
(R):5'- GCACCAATACACACATTTTTGTC -3'
Posted On2014-06-25