Incidental Mutation 'R0086:Olfr936'
ID208401
Institutional Source Beutler Lab
Gene Symbol Olfr936
Ensembl Gene ENSMUSG00000095194
Gene Nameolfactory receptor 936
SynonymsEG628171, GA_x6K02T2PVTD-32743332-32742397, MOR171-37
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0086 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39046614-39047549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39046895 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 175 (T175A)
Ref Sequence ENSEMBL: ENSMUSP00000137209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178303] [ENSMUST00000216912]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104850
Predicted Effect probably benign
Transcript: ENSMUST00000178303
AA Change: T175A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137209
Gene: ENSMUSG00000095194
AA Change: T175A

DomainStartEndE-ValueType
Pfam:7tm_1 1 246 6e-21 PFAM
Pfam:7tm_4 1 264 6.9e-49 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000216912
AA Change: Y219C
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Olfr936
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Olfr936 APN 9 39047413 missense unknown
R0561:Olfr936 UTSW 9 39047373 missense probably damaging 0.99
R0650:Olfr936 UTSW 9 39046700 missense probably benign 0.01
R1221:Olfr936 UTSW 9 39047187 missense probably damaging 1.00
R1384:Olfr936 UTSW 9 39046904 missense possibly damaging 0.70
R1680:Olfr936 UTSW 9 39047000 missense probably benign 0.43
R1733:Olfr936 UTSW 9 39047382 missense unknown
R3767:Olfr936 UTSW 9 39047411 missense unknown
R4786:Olfr936 UTSW 9 39047487 nonsense probably null
R4944:Olfr936 UTSW 9 39046862 missense probably damaging 1.00
R5186:Olfr936 UTSW 9 39046969 nonsense probably null
R5403:Olfr936 UTSW 9 39046703 missense probably damaging 1.00
R6037:Olfr936 UTSW 9 39047107 missense probably damaging 1.00
R6037:Olfr936 UTSW 9 39047107 missense probably damaging 1.00
R6156:Olfr936 UTSW 9 39047375 missense possibly damaging 0.90
R6217:Olfr936 UTSW 9 39046743 makesense probably null
R6711:Olfr936 UTSW 9 39046866 makesense probably null
R6919:Olfr936 UTSW 9 39047531 utr 5 prime probably benign
R7022:Olfr936 UTSW 9 39047083 nonsense probably null
R7275:Olfr936 UTSW 9 39047519 utr 5 prime probably benign
R7290:Olfr936 UTSW 9 39047398 missense unknown
R7644:Olfr936 UTSW 9 39047342 missense probably damaging 1.00
Z1176:Olfr936 UTSW 9 39046919 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTGGCAGTGACCACCAAGAAGAA -3'
(R):5'- TGCTGGCTGCAATGGCATATGA -3'

Sequencing Primer
(F):5'- CCTTGTTCCTCAGACTGTAGATTAGG -3'
(R):5'- GCATATGATCGCTATGTTGCC -3'
Posted On2014-06-25