Incidental Mutation 'R0086:Slc22a14'
ID208402
Institutional Source Beutler Lab
Gene Symbol Slc22a14
Ensembl Gene ENSMUSG00000070280
Gene Namesolute carrier family 22 (organic cation transporter), member 14
SynonymsLOC382113
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0086 (G1)
Quality Score138
Status Validated
Chromosome9
Chromosomal Location119169455-119365553 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) C to T at 119222738 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170400] [ENSMUST00000173185]
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000134179
Gene: ENSMUSG00000092212

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 302 6e-27 PFAM
Pfam:MFS_1 141 318 3.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173185
SMART Domains Protein: ENSMUSP00000134667
Gene: ENSMUSG00000092212

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:MFS_1 141 349 3.4e-12 PFAM
Pfam:Sugar_tr 162 333 7e-9 PFAM
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 3. The encoded protein is a transmembrane protein which is thought to transport small molecules and since this protein is conserved among several species, it is suggested to have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Scnn1a T C 6: 125,342,587 probably benign Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Slc22a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Slc22a14 APN 9 119178513 missense possibly damaging 0.58
R0505:Slc22a14 UTSW 9 119172034 splice site probably benign
R0593:Slc22a14 UTSW 9 119169851 missense probably benign 0.15
R0597:Slc22a14 UTSW 9 119172124 missense probably damaging 0.99
R0674:Slc22a14 UTSW 9 119178542 missense probably damaging 1.00
R1290:Slc22a14 UTSW 9 119178452 missense probably damaging 1.00
R1459:Slc22a14 UTSW 9 119223761 missense possibly damaging 0.70
R1706:Slc22a14 UTSW 9 119180984 missense probably benign 0.06
R3980:Slc22a14 UTSW 9 119178486 missense probably benign 0.02
R4166:Slc22a14 UTSW 9 119178432 missense probably benign 0.00
R4166:Slc22a14 UTSW 9 119179868 missense possibly damaging 0.53
R4574:Slc22a14 UTSW 9 119179495 missense probably damaging 0.99
R4959:Slc22a14 UTSW 9 119174035 small deletion probably benign
R4973:Slc22a14 UTSW 9 119174035 small deletion probably benign
R5273:Slc22a14 UTSW 9 119170638 missense probably benign 0.08
R5330:Slc22a14 UTSW 9 119230596 missense probably damaging 1.00
R5331:Slc22a14 UTSW 9 119230596 missense probably damaging 1.00
R5543:Slc22a14 UTSW 9 119173608 missense probably benign 0.01
R5801:Slc22a14 UTSW 9 119172083 missense probably benign 0.01
R6521:Slc22a14 UTSW 9 119220769 intron probably null
R6622:Slc22a14 UTSW 9 119170577 missense possibly damaging 0.81
R6948:Slc22a14 UTSW 9 119231416 missense probably damaging 1.00
R7027:Slc22a14 UTSW 9 119231215 intron probably null
R7731:Slc22a14 UTSW 9 119170611 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCAGCAGCTCTTACCTGATGATG -3'
(R):5'- GGCTCTAACTGTGACGGTTTCTCC -3'

Sequencing Primer
(F):5'- ACCACCGTGGGAAGATCTG -3'
(R):5'- CTGGTCTGAACGCATTAAGC -3'
Posted On2014-06-25