Incidental Mutation 'R0681:Ahdc1'
ID208414
Institutional Source Beutler Lab
Gene Symbol Ahdc1
Ensembl Gene ENSMUSG00000037692
Gene NameAT hook, DNA binding motif, containing 1
Synonyms
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R0681 (G1)
Quality Score63
Status Validated
Chromosome4
Chromosomal Location133011260-133078110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133065516 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1356 (F1356S)
Ref Sequence ENSEMBL: ENSMUSP00000101536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044521] [ENSMUST00000105914] [ENSMUST00000105915] [ENSMUST00000105916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044521
AA Change: F1356S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047113
Gene: ENSMUSG00000037692
AA Change: F1356S

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105914
AA Change: F1356S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101534
Gene: ENSMUSG00000037692
AA Change: F1356S

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
Pfam:DUF4683 559 639 6.4e-15 PFAM
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105915
AA Change: F1356S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101535
Gene: ENSMUSG00000037692
AA Change: F1356S

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105916
AA Change: F1356S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101536
Gene: ENSMUSG00000037692
AA Change: F1356S

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156677
Meta Mutation Damage Score 0.6167 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two AT-hooks, which likely function in DNA binding. Mutations in this gene were found in individuals with Xia-Gibbs syndrome. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Ahdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Ahdc1 APN 4 133063062 missense probably benign 0.33
IGL02293:Ahdc1 APN 4 133065618 missense possibly damaging 0.85
IGL02338:Ahdc1 APN 4 133062549 missense possibly damaging 0.73
IGL02828:Ahdc1 APN 4 133062921 missense possibly damaging 0.96
IGL02859:Ahdc1 APN 4 133062692 missense possibly damaging 0.53
IGL02859:Ahdc1 APN 4 133062693 missense probably damaging 0.99
IGL02901:Ahdc1 APN 4 133064934 missense possibly damaging 0.85
IGL03323:Ahdc1 APN 4 133065428 missense probably benign
FR4304:Ahdc1 UTSW 4 133062759 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062757 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062760 small insertion probably benign
FR4737:Ahdc1 UTSW 4 133062759 small insertion probably benign
R0325:Ahdc1 UTSW 4 133062719 missense unknown
R0550:Ahdc1 UTSW 4 133063037 missense probably benign 0.33
R0683:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0731:Ahdc1 UTSW 4 133062951 missense possibly damaging 0.86
R0751:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1137:Ahdc1 UTSW 4 133062113 missense possibly damaging 0.68
R1184:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1331:Ahdc1 UTSW 4 133063691 missense probably benign 0.18
R1599:Ahdc1 UTSW 4 133064936 missense possibly damaging 0.91
R2202:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2205:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2261:Ahdc1 UTSW 4 133063163 missense unknown
R2262:Ahdc1 UTSW 4 133063163 missense unknown
R3683:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3684:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3685:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3713:Ahdc1 UTSW 4 133065986 missense possibly damaging 0.85
R4027:Ahdc1 UTSW 4 133064165 missense possibly damaging 0.73
R4807:Ahdc1 UTSW 4 133064313 missense possibly damaging 0.86
R4987:Ahdc1 UTSW 4 133064320 missense possibly damaging 0.53
R5126:Ahdc1 UTSW 4 133063522 missense probably benign 0.18
R5276:Ahdc1 UTSW 4 133062798 missense possibly damaging 0.93
R5680:Ahdc1 UTSW 4 133065596 missense probably benign
R5997:Ahdc1 UTSW 4 133063895 missense probably benign 0.05
R6050:Ahdc1 UTSW 4 133065891 missense possibly damaging 0.85
R6271:Ahdc1 UTSW 4 133064724 missense possibly damaging 0.73
R6410:Ahdc1 UTSW 4 133062899 missense probably damaging 0.97
R6519:Ahdc1 UTSW 4 133064768 missense possibly damaging 0.86
R6970:Ahdc1 UTSW 4 133062345 missense possibly damaging 0.96
R7199:Ahdc1 UTSW 4 133064624 missense probably benign 0.33
R7202:Ahdc1 UTSW 4 133061887 nonsense probably null
R7576:Ahdc1 UTSW 4 133065002 missense possibly damaging 0.91
R7614:Ahdc1 UTSW 4 133063514 missense probably benign 0.18
R7794:Ahdc1 UTSW 4 133063978 missense possibly damaging 0.70
R7875:Ahdc1 UTSW 4 133063850 missense possibly damaging 0.53
R7958:Ahdc1 UTSW 4 133063850 missense possibly damaging 0.53
R8016:Ahdc1 UTSW 4 133062915 missense possibly damaging 0.96
RF017:Ahdc1 UTSW 4 133062751 small insertion probably benign
RF020:Ahdc1 UTSW 4 133064277 missense possibly damaging 0.96
T0722:Ahdc1 UTSW 4 133062754 small insertion probably benign
T0975:Ahdc1 UTSW 4 133062754 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTTTCAGAGTAGCTCAAAGCCC -3'
(R):5'- GCAACTCTTCCTTGAAGCCTAGCG -3'

Sequencing Primer
(F):5'- GCGGCCAAAGCCAAGTTC -3'
(R):5'- AGCGTTGGTGAACAGGTG -3'
Posted On2014-06-25