Incidental Mutation 'R0681:Sec22a'
ID208423
Institutional Source Beutler Lab
Gene Symbol Sec22a
Ensembl Gene ENSMUSG00000034473
Gene NameSEC22 homolog A, vesicle trafficking protein
SynonymsSec22l2, 1810005C06Rik
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R0681 (G1)
Quality Score51
Status Validated
Chromosome16
Chromosomal Location35311131-35363918 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 35361556 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043521] [ENSMUST00000154064] [ENSMUST00000232420]
Predicted Effect probably null
Transcript: ENSMUST00000043521
SMART Domains Protein: ENSMUSP00000039568
Gene: ENSMUSG00000034473

DomainStartEndE-ValueType
Longin 36 118 3.01e-23 SMART
transmembrane domain 188 210 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
transmembrane domain 254 271 N/A INTRINSIC
transmembrane domain 276 295 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141087
Predicted Effect probably benign
Transcript: ENSMUST00000154064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154216
Predicted Effect probably null
Transcript: ENSMUST00000232420
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the member of the SEC22 family of vesicle trafficking proteins. This protein has similarity to rat SEC22 and may act in the early stages of the secretory pathway. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Sec22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02730:Sec22a APN 16 35314100 missense probably damaging 1.00
IGL03249:Sec22a APN 16 35347763 missense probably damaging 1.00
R1568:Sec22a UTSW 16 35347628 missense probably benign 0.17
R1634:Sec22a UTSW 16 35318873 intron probably benign
R1863:Sec22a UTSW 16 35347718 missense probably damaging 1.00
R2200:Sec22a UTSW 16 35314157 missense probably damaging 0.97
R4114:Sec22a UTSW 16 35318832 missense probably damaging 1.00
R4115:Sec22a UTSW 16 35318832 missense probably damaging 1.00
R4116:Sec22a UTSW 16 35318832 missense probably damaging 1.00
R5086:Sec22a UTSW 16 35347742 nonsense probably null
R5986:Sec22a UTSW 16 35314091 missense probably damaging 1.00
R7042:Sec22a UTSW 16 35329515 missense probably benign 0.23
R7623:Sec22a UTSW 16 35329524 missense probably benign 0.18
R7878:Sec22a UTSW 16 35347635 missense probably benign
R7961:Sec22a UTSW 16 35347635 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGTCAGCACAGGGTAAAGTCAC -3'
(R):5'- ATGGACTACCGCTGTCTGCATCCAC -3'

Sequencing Primer
(F):5'- ATCCTATTGCCCAGTCTTAAAGG -3'
(R):5'- TCCACTGATTATGAGCAGAGC -3'
Posted On2014-06-25