Incidental Mutation 'R1864:Hipk2'
ID208486
Institutional Source Beutler Lab
Gene Symbol Hipk2
Ensembl Gene ENSMUSG00000061436
Gene Namehomeodomain interacting protein kinase 2
Synonyms1110014O20Rik, Stank, B230339E18Rik
MMRRC Submission 039887-MU
Accession Numbers

Ncbi RefSeq: NM_001136065.1, NM_010433.2; MGI: 1314872

Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R1864 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location38694390-38876165 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 38718935 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160360] [ENSMUST00000160360] [ENSMUST00000160962] [ENSMUST00000160962] [ENSMUST00000161779] [ENSMUST00000161779] [ENSMUST00000162359] [ENSMUST00000162359]
Predicted Effect probably null
Transcript: ENSMUST00000160360
SMART Domains Protein: ENSMUSP00000125500
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 895 909 N/A INTRINSIC
low complexity region 963 992 N/A INTRINSIC
low complexity region 998 1018 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160360
SMART Domains Protein: ENSMUSP00000125500
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 895 909 N/A INTRINSIC
low complexity region 963 992 N/A INTRINSIC
low complexity region 998 1018 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160962
SMART Domains Protein: ENSMUSP00000125572
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
low complexity region 149 173 N/A INTRINSIC
S_TKc 192 520 3.05e-78 SMART
low complexity region 888 902 N/A INTRINSIC
low complexity region 956 985 N/A INTRINSIC
low complexity region 991 1011 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160962
SMART Domains Protein: ENSMUSP00000125572
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
low complexity region 149 173 N/A INTRINSIC
S_TKc 192 520 3.05e-78 SMART
low complexity region 888 902 N/A INTRINSIC
low complexity region 956 985 N/A INTRINSIC
low complexity region 991 1011 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161779
SMART Domains Protein: ENSMUSP00000124133
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 923 937 N/A INTRINSIC
low complexity region 991 1020 N/A INTRINSIC
low complexity region 1026 1046 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161779
SMART Domains Protein: ENSMUSP00000124133
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 923 937 N/A INTRINSIC
low complexity region 991 1020 N/A INTRINSIC
low complexity region 1026 1046 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162359
SMART Domains Protein: ENSMUSP00000125150
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 896 910 N/A INTRINSIC
low complexity region 964 993 N/A INTRINSIC
low complexity region 999 1019 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162359
SMART Domains Protein: ENSMUSP00000125150
Gene: ENSMUSG00000061436

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 896 910 N/A INTRINSIC
low complexity region 964 993 N/A INTRINSIC
low complexity region 999 1019 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype Strain: 3624127; 3487301; 4429497
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display decreased apoptosis and increased neuron numbers in the trigeminal ganglion. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(3)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agtpbp1 A G 13: 59,450,202 Y1198H possibly damaging Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
AI314180 T A 4: 58,849,942 H427L possibly damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ankrd50 A T 3: 38,454,461 N329K probably benign Het
Ano4 C A 10: 88,971,391 G741V probably damaging Het
Anxa1 T C 19: 20,379,689 D191G probably benign Het
Apc2 C T 10: 80,313,648 T1512I probably damaging Het
Aph1b A T 9: 66,794,113 C81S probably benign Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Arhgef28 A T 13: 97,994,132 H399Q probably benign Het
Asic5 A G 3: 82,011,987 E304G probably benign Het
B4galnt4 A G 7: 141,070,533 Y771C probably damaging Het
Birc2 G T 9: 7,819,517 Q465K probably benign Het
Btla C T 16: 45,250,374 T232I probably damaging Het
Ccdc84 A G 9: 44,417,721 C66R probably damaging Het
Ccl7 G T 11: 82,046,552 K37N probably benign Het
Cdk17 T C 10: 93,226,105 V233A probably damaging Het
Cilp2 C A 8: 69,881,323 Q1008H probably damaging Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Clcnka T C 4: 141,392,802 T269A probably damaging Het
Col12a1 A T 9: 79,627,103 probably null Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cyp3a25 T C 5: 145,994,929 D123G probably damaging Het
D630003M21Rik A T 2: 158,203,185 L808Q probably damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx15 T C 5: 52,184,701 T92A possibly damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Diaph2 G A X: 129,960,127 R473Q probably damaging Het
Dnd1 A G 18: 36,766,004 C11R possibly damaging Het
Dock1 A C 7: 135,146,507 D1566A probably benign Het
Drp2 A G X: 134,427,115 I43V probably benign Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Emilin1 A G 5: 30,918,590 E725G probably damaging Het
Eml2 A G 7: 19,201,878 Y487C probably damaging Het
Epg5 T A 18: 77,975,031 L919H probably damaging Het
Fam187a T A 11: 102,886,011 S214T probably damaging Het
Flna T C X: 74,240,263 T521A probably benign Het
Foxi1 T A 11: 34,207,531 I165F probably damaging Het
Fxr2 A T 11: 69,652,277 K633N probably benign Het
Gdpd5 T C 7: 99,448,999 I209T probably benign Het
Gm13212 A T 4: 145,622,428 Q145L possibly damaging Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Grm7 A T 6: 111,080,423 D328V probably benign Het
Heatr6 T C 11: 83,769,230 S534P probably damaging Het
Heph A G X: 96,529,486 T792A probably damaging Het
Hps3 T A 3: 20,019,959 probably null Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Insc T C 7: 114,842,178 I409T probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Kcnma1 T A 14: 23,803,162 Q108L probably damaging Het
Klc3 A G 7: 19,398,041 V137A probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Lgr4 T A 2: 110,011,397 F576I possibly damaging Het
Lypd6b A G 2: 49,947,447 I144V possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Mitf A T 6: 98,010,422 N159I probably damaging Het
Morc1 T C 16: 48,592,530 I678T probably benign Het
Muc4 A G 16: 32,756,251 probably benign Het
Myo7a T C 7: 98,052,256 Y2115C probably damaging Het
Myof T C 19: 37,986,705 I182V probably benign Het
Ncor1 A G 11: 62,381,419 V635A probably damaging Het
Neb G T 2: 52,212,760 Y4257* probably null Het
Npr2 T A 4: 43,641,258 V428E probably benign Het
Nufip2 A G 11: 77,692,298 D346G probably damaging Het
Obsl1 G A 1: 75,493,109 S1088F probably benign Het
Olfr1262 T A 2: 90,002,481 V25E probably benign Het
Olfr1282 C T 2: 111,335,707 V124M possibly damaging Het
Olfr204 A G 16: 59,315,015 Y131H probably damaging Het
Olfr705 T C 7: 106,713,823 N286S possibly damaging Het
Olfr877 T A 9: 37,855,264 Y149N probably damaging Het
Olfr982 T G 9: 40,074,785 I163M possibly damaging Het
Pdgfrb G A 18: 61,071,717 V550I probably benign Het
Pi4ka A T 16: 17,367,525 L237* probably null Het
Pla2r1 G A 2: 60,428,711 T1111M probably benign Het
Plxnd1 A T 6: 115,969,441 probably null Het
Pnp G C 14: 50,947,973 A67P probably benign Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prom2 T C 2: 127,539,787 D203G probably benign Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rnf115 A G 3: 96,727,837 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rusc2 C A 4: 43,421,719 A713D possibly damaging Het
Ryr3 A T 2: 112,730,328 H3009Q possibly damaging Het
Serpina1d C A 12: 103,767,997 C16F probably benign Het
Serpinf2 G T 11: 75,437,483 R80S possibly damaging Het
Sh2d4a C A 8: 68,329,315 Q192K probably benign Het
Sh3d21 T A 4: 126,150,936 probably null Het
Sh3rf2 T A 18: 42,053,981 L55Q probably damaging Het
Shc4 T C 2: 125,639,367 D255G probably damaging Het
Skint2 T A 4: 112,625,909 H170Q probably benign Het
Slc29a4 A G 5: 142,717,754 Y261C probably damaging Het
Slc35a5 A T 16: 45,143,708 N102K possibly damaging Het
Slc38a3 A T 9: 107,655,953 I307K probably damaging Het
Sv2b A T 7: 75,124,080 S548T probably benign Het
Tgfbi T C 13: 56,632,881 S524P probably benign Het
Tgm5 T C 2: 121,075,218 D152G probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Trpm1 A G 7: 64,268,016 K1258R probably damaging Het
Ttc22 T C 4: 106,636,806 V321A probably benign Het
Ube2c C A 2: 164,770,023 A15E probably benign Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Umod A T 7: 119,463,255 L631M probably damaging Het
Ush1c G A 7: 46,219,392 Q373* probably null Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Wnt8b T C 19: 44,493,590 L14P probably benign Het
Wrn G A 8: 33,288,864 A563V probably damaging Het
Zfp608 A G 18: 54,897,911 S986P probably benign Het
Znrf3 T C 11: 5,283,373 H228R possibly damaging Het
Other mutations in Hipk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Hipk2 APN 6 38819322 splice site probably benign
IGL00814:Hipk2 APN 6 38818549 missense probably damaging 1.00
IGL00907:Hipk2 APN 6 38818273 missense probably damaging 1.00
IGL01350:Hipk2 APN 6 38818315 missense probably damaging 1.00
IGL01714:Hipk2 APN 6 38819182 missense probably damaging 1.00
IGL01893:Hipk2 APN 6 38818395 missense probably benign 0.05
IGL02028:Hipk2 APN 6 38818756 missense possibly damaging 0.67
IGL02133:Hipk2 APN 6 38819134 missense probably benign
IGL02135:Hipk2 APN 6 38818999 missense possibly damaging 0.90
IGL02543:Hipk2 APN 6 38703501 missense possibly damaging 0.95
IGL02630:Hipk2 APN 6 38818521 missense possibly damaging 0.48
IGL02896:Hipk2 APN 6 38698447 missense probably damaging 1.00
IGL02900:Hipk2 APN 6 38729944 missense probably damaging 0.96
IGL03345:Hipk2 APN 6 38748002 splice site probably benign
R0070:Hipk2 UTSW 6 38818984 nonsense probably null
R0070:Hipk2 UTSW 6 38818984 nonsense probably null
R0092:Hipk2 UTSW 6 38743229 missense probably damaging 0.97
R0184:Hipk2 UTSW 6 38718931 missense possibly damaging 0.77
R0494:Hipk2 UTSW 6 38729989 missense probably benign 0.03
R0617:Hipk2 UTSW 6 38747485 missense possibly damaging 0.70
R0720:Hipk2 UTSW 6 38698556 missense probably damaging 1.00
R1812:Hipk2 UTSW 6 38698163 missense probably benign 0.14
R1919:Hipk2 UTSW 6 38818984 nonsense probably null
R1995:Hipk2 UTSW 6 38715974 missense probably damaging 1.00
R2079:Hipk2 UTSW 6 38818785 missense probably damaging 1.00
R2238:Hipk2 UTSW 6 38729915 splice site probably benign
R2384:Hipk2 UTSW 6 38818371 missense probably damaging 0.99
R3775:Hipk2 UTSW 6 38743094 missense probably damaging 0.99
R3792:Hipk2 UTSW 6 38698556 missense probably damaging 1.00
R3841:Hipk2 UTSW 6 38818926 missense probably damaging 1.00
R3883:Hipk2 UTSW 6 38699265 missense probably damaging 1.00
R4471:Hipk2 UTSW 6 38736922 intron probably benign
R4724:Hipk2 UTSW 6 38698392 missense probably benign 0.10
R4838:Hipk2 UTSW 6 38818404 missense possibly damaging 0.94
R4843:Hipk2 UTSW 6 38819257 missense possibly damaging 0.94
R5040:Hipk2 UTSW 6 38730881 missense possibly damaging 0.82
R5044:Hipk2 UTSW 6 38818879 missense probably benign 0.06
R5320:Hipk2 UTSW 6 38818277 missense probably damaging 1.00
R5409:Hipk2 UTSW 6 38730042 missense probably damaging 1.00
R5682:Hipk2 UTSW 6 38737473 missense possibly damaging 0.50
R5695:Hipk2 UTSW 6 38818875 missense possibly damaging 0.64
R5876:Hipk2 UTSW 6 38730867 critical splice donor site probably null
R6309:Hipk2 UTSW 6 38698511 missense probably damaging 1.00
R6612:Hipk2 UTSW 6 38818873 missense probably benign 0.04
R6815:Hipk2 UTSW 6 38818842 missense probably damaging 1.00
R7104:Hipk2 UTSW 6 38818644 missense probably damaging 0.98
R7124:Hipk2 UTSW 6 38818478 nonsense probably null
R7238:Hipk2 UTSW 6 38716057 missense probably benign 0.45
R7712:Hipk2 UTSW 6 38703634 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGACTGGTGCTGCTTACTC -3'
(R):5'- AGGGATTTTACAGGTCAGAGGC -3'

Sequencing Primer
(F):5'- CTGCTTACTCTTCCTGGAGGAG -3'
(R):5'- TTACAGGTCAGAGGCTACTCATC -3'
Posted On2014-06-30