Incidental Mutation 'R1864:Clcn1'
ID208487
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission 039887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1864 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42305541 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 442 (D442E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031894
AA Change: D514E

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: D514E

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163235
SMART Domains Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163936
AA Change: D442E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: D442E

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agtpbp1 A G 13: 59,450,202 Y1198H possibly damaging Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
AI314180 T A 4: 58,849,942 H427L possibly damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ankrd50 A T 3: 38,454,461 N329K probably benign Het
Ano4 C A 10: 88,971,391 G741V probably damaging Het
Anxa1 T C 19: 20,379,689 D191G probably benign Het
Apc2 C T 10: 80,313,648 T1512I probably damaging Het
Aph1b A T 9: 66,794,113 C81S probably benign Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Arhgef28 A T 13: 97,994,132 H399Q probably benign Het
Asic5 A G 3: 82,011,987 E304G probably benign Het
B4galnt4 A G 7: 141,070,533 Y771C probably damaging Het
Birc2 G T 9: 7,819,517 Q465K probably benign Het
Btla C T 16: 45,250,374 T232I probably damaging Het
Ccdc84 A G 9: 44,417,721 C66R probably damaging Het
Ccl7 G T 11: 82,046,552 K37N probably benign Het
Cdk17 T C 10: 93,226,105 V233A probably damaging Het
Cilp2 C A 8: 69,881,323 Q1008H probably damaging Het
Clcnka T C 4: 141,392,802 T269A probably damaging Het
Col12a1 A T 9: 79,627,103 probably null Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cyp3a25 T C 5: 145,994,929 D123G probably damaging Het
D630003M21Rik A T 2: 158,203,185 L808Q probably damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx15 T C 5: 52,184,701 T92A possibly damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Diaph2 G A X: 129,960,127 R473Q probably damaging Het
Dnd1 A G 18: 36,766,004 C11R possibly damaging Het
Dock1 A C 7: 135,146,507 D1566A probably benign Het
Drp2 A G X: 134,427,115 I43V probably benign Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Emilin1 A G 5: 30,918,590 E725G probably damaging Het
Eml2 A G 7: 19,201,878 Y487C probably damaging Het
Epg5 T A 18: 77,975,031 L919H probably damaging Het
Fam187a T A 11: 102,886,011 S214T probably damaging Het
Flna T C X: 74,240,263 T521A probably benign Het
Foxi1 T A 11: 34,207,531 I165F probably damaging Het
Fxr2 A T 11: 69,652,277 K633N probably benign Het
Gdpd5 T C 7: 99,448,999 I209T probably benign Het
Gm13212 A T 4: 145,622,428 Q145L possibly damaging Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Grm7 A T 6: 111,080,423 D328V probably benign Het
Heatr6 T C 11: 83,769,230 S534P probably damaging Het
Heph A G X: 96,529,486 T792A probably damaging Het
Hipk2 T A 6: 38,718,935 probably null Het
Hps3 T A 3: 20,019,959 probably null Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Insc T C 7: 114,842,178 I409T probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Kcnma1 T A 14: 23,803,162 Q108L probably damaging Het
Klc3 A G 7: 19,398,041 V137A probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Lgr4 T A 2: 110,011,397 F576I possibly damaging Het
Lypd6b A G 2: 49,947,447 I144V possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Mitf A T 6: 98,010,422 N159I probably damaging Het
Morc1 T C 16: 48,592,530 I678T probably benign Het
Muc4 A G 16: 32,756,251 probably benign Het
Myo7a T C 7: 98,052,256 Y2115C probably damaging Het
Myof T C 19: 37,986,705 I182V probably benign Het
Ncor1 A G 11: 62,381,419 V635A probably damaging Het
Neb G T 2: 52,212,760 Y4257* probably null Het
Npr2 T A 4: 43,641,258 V428E probably benign Het
Nufip2 A G 11: 77,692,298 D346G probably damaging Het
Obsl1 G A 1: 75,493,109 S1088F probably benign Het
Olfr1262 T A 2: 90,002,481 V25E probably benign Het
Olfr1282 C T 2: 111,335,707 V124M possibly damaging Het
Olfr204 A G 16: 59,315,015 Y131H probably damaging Het
Olfr705 T C 7: 106,713,823 N286S possibly damaging Het
Olfr877 T A 9: 37,855,264 Y149N probably damaging Het
Olfr982 T G 9: 40,074,785 I163M possibly damaging Het
Pdgfrb G A 18: 61,071,717 V550I probably benign Het
Pi4ka A T 16: 17,367,525 L237* probably null Het
Pla2r1 G A 2: 60,428,711 T1111M probably benign Het
Plxnd1 A T 6: 115,969,441 probably null Het
Pnp G C 14: 50,947,973 A67P probably benign Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prom2 T C 2: 127,539,787 D203G probably benign Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rnf115 A G 3: 96,727,837 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rusc2 C A 4: 43,421,719 A713D possibly damaging Het
Ryr3 A T 2: 112,730,328 H3009Q possibly damaging Het
Serpina1d C A 12: 103,767,997 C16F probably benign Het
Serpinf2 G T 11: 75,437,483 R80S possibly damaging Het
Sh2d4a C A 8: 68,329,315 Q192K probably benign Het
Sh3d21 T A 4: 126,150,936 probably null Het
Sh3rf2 T A 18: 42,053,981 L55Q probably damaging Het
Shc4 T C 2: 125,639,367 D255G probably damaging Het
Skint2 T A 4: 112,625,909 H170Q probably benign Het
Slc29a4 A G 5: 142,717,754 Y261C probably damaging Het
Slc35a5 A T 16: 45,143,708 N102K possibly damaging Het
Slc38a3 A T 9: 107,655,953 I307K probably damaging Het
Sv2b A T 7: 75,124,080 S548T probably benign Het
Tgfbi T C 13: 56,632,881 S524P probably benign Het
Tgm5 T C 2: 121,075,218 D152G probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Trpm1 A G 7: 64,268,016 K1258R probably damaging Het
Ttc22 T C 4: 106,636,806 V321A probably benign Het
Ube2c C A 2: 164,770,023 A15E probably benign Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Umod A T 7: 119,463,255 L631M probably damaging Het
Ush1c G A 7: 46,219,392 Q373* probably null Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Wnt8b T C 19: 44,493,590 L14P probably benign Het
Wrn G A 8: 33,288,864 A563V probably damaging Het
Zfp608 A G 18: 54,897,911 S986P probably benign Het
Znrf3 T C 11: 5,283,373 H228R possibly damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 splice site probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
faint UTSW 6 42307265 missense probably damaging 1.00
jack_spratt UTSW 6 42310581 missense probably benign
Limitations UTSW 6 42310063 missense possibly damaging 0.79
maimed UTSW 6 42298820 missense probably damaging 1.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42291389 missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42293462 missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42298838 missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42291334 nonsense probably null
R7663:Clcn1 UTSW 6 42310063 missense possibly damaging 0.79
R7807:Clcn1 UTSW 6 42310348 splice site probably null
R7954:Clcn1 UTSW 6 42286691 unclassified probably benign
R8026:Clcn1 UTSW 6 42307661 critical splice donor site probably null
R8045:Clcn1 UTSW 6 42290694 missense probably damaging 1.00
R8499:Clcn1 UTSW 6 42307199 missense probably damaging 1.00
R8523:Clcn1 UTSW 6 42307589 nonsense probably null
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Z1176:Clcn1 UTSW 6 42307567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCATACTGATAGCTACAATCTGGG -3'
(R):5'- GCAGAGCCAAAAGCCAGTTG -3'

Sequencing Primer
(F):5'- CCGGTGGGAAAACCTAGGATG -3'
(R):5'- GCCAAAAGCCAGTTGTTTGAAC -3'
Posted On2014-06-30