Incidental Mutation 'R1864:Trpm1'
ID208497
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Nametransient receptor potential cation channel, subfamily M, member 1
SynonymsMlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission 039887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1864 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location64153835-64269775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64268016 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1258 (K1258R)
Ref Sequence ENSEMBL: ENSMUSP00000146226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085222
AA Change: K1252R

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: K1252R

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107525
AA Change: K1258R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: K1258R

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
Pfam:Ion_trans 876 1138 7.6e-22 PFAM
transmembrane domain 1156 1173 N/A INTRINSIC
Pfam:TRPM_tetra 1230 1285 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205466
Predicted Effect possibly damaging
Transcript: ENSMUST00000206263
AA Change: K1136R

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: K1258R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
AA Change: K368R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably damaging
Transcript: ENSMUST00000206848
AA Change: K152R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agtpbp1 A G 13: 59,450,202 Y1198H possibly damaging Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
AI314180 T A 4: 58,849,942 H427L possibly damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ankrd50 A T 3: 38,454,461 N329K probably benign Het
Ano4 C A 10: 88,971,391 G741V probably damaging Het
Anxa1 T C 19: 20,379,689 D191G probably benign Het
Apc2 C T 10: 80,313,648 T1512I probably damaging Het
Aph1b A T 9: 66,794,113 C81S probably benign Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Arhgef28 A T 13: 97,994,132 H399Q probably benign Het
Asic5 A G 3: 82,011,987 E304G probably benign Het
B4galnt4 A G 7: 141,070,533 Y771C probably damaging Het
Birc2 G T 9: 7,819,517 Q465K probably benign Het
Btla C T 16: 45,250,374 T232I probably damaging Het
Ccdc84 A G 9: 44,417,721 C66R probably damaging Het
Ccl7 G T 11: 82,046,552 K37N probably benign Het
Cdk17 T C 10: 93,226,105 V233A probably damaging Het
Cilp2 C A 8: 69,881,323 Q1008H probably damaging Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Clcnka T C 4: 141,392,802 T269A probably damaging Het
Col12a1 A T 9: 79,627,103 probably null Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cyp3a25 T C 5: 145,994,929 D123G probably damaging Het
D630003M21Rik A T 2: 158,203,185 L808Q probably damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx15 T C 5: 52,184,701 T92A possibly damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Diaph2 G A X: 129,960,127 R473Q probably damaging Het
Dnd1 A G 18: 36,766,004 C11R possibly damaging Het
Dock1 A C 7: 135,146,507 D1566A probably benign Het
Drp2 A G X: 134,427,115 I43V probably benign Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Emilin1 A G 5: 30,918,590 E725G probably damaging Het
Eml2 A G 7: 19,201,878 Y487C probably damaging Het
Epg5 T A 18: 77,975,031 L919H probably damaging Het
Fam187a T A 11: 102,886,011 S214T probably damaging Het
Flna T C X: 74,240,263 T521A probably benign Het
Foxi1 T A 11: 34,207,531 I165F probably damaging Het
Fxr2 A T 11: 69,652,277 K633N probably benign Het
Gdpd5 T C 7: 99,448,999 I209T probably benign Het
Gm13212 A T 4: 145,622,428 Q145L possibly damaging Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Grm7 A T 6: 111,080,423 D328V probably benign Het
Heatr6 T C 11: 83,769,230 S534P probably damaging Het
Heph A G X: 96,529,486 T792A probably damaging Het
Hipk2 T A 6: 38,718,935 probably null Het
Hps3 T A 3: 20,019,959 probably null Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Insc T C 7: 114,842,178 I409T probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Kcnma1 T A 14: 23,803,162 Q108L probably damaging Het
Klc3 A G 7: 19,398,041 V137A probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Lgr4 T A 2: 110,011,397 F576I possibly damaging Het
Lypd6b A G 2: 49,947,447 I144V possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Mitf A T 6: 98,010,422 N159I probably damaging Het
Morc1 T C 16: 48,592,530 I678T probably benign Het
Muc4 A G 16: 32,756,251 probably benign Het
Myo7a T C 7: 98,052,256 Y2115C probably damaging Het
Myof T C 19: 37,986,705 I182V probably benign Het
Ncor1 A G 11: 62,381,419 V635A probably damaging Het
Neb G T 2: 52,212,760 Y4257* probably null Het
Npr2 T A 4: 43,641,258 V428E probably benign Het
Nufip2 A G 11: 77,692,298 D346G probably damaging Het
Obsl1 G A 1: 75,493,109 S1088F probably benign Het
Olfr1262 T A 2: 90,002,481 V25E probably benign Het
Olfr1282 C T 2: 111,335,707 V124M possibly damaging Het
Olfr204 A G 16: 59,315,015 Y131H probably damaging Het
Olfr705 T C 7: 106,713,823 N286S possibly damaging Het
Olfr877 T A 9: 37,855,264 Y149N probably damaging Het
Olfr982 T G 9: 40,074,785 I163M possibly damaging Het
Pdgfrb G A 18: 61,071,717 V550I probably benign Het
Pi4ka A T 16: 17,367,525 L237* probably null Het
Pla2r1 G A 2: 60,428,711 T1111M probably benign Het
Plxnd1 A T 6: 115,969,441 probably null Het
Pnp G C 14: 50,947,973 A67P probably benign Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prom2 T C 2: 127,539,787 D203G probably benign Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rnf115 A G 3: 96,727,837 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rusc2 C A 4: 43,421,719 A713D possibly damaging Het
Ryr3 A T 2: 112,730,328 H3009Q possibly damaging Het
Serpina1d C A 12: 103,767,997 C16F probably benign Het
Serpinf2 G T 11: 75,437,483 R80S possibly damaging Het
Sh2d4a C A 8: 68,329,315 Q192K probably benign Het
Sh3d21 T A 4: 126,150,936 probably null Het
Sh3rf2 T A 18: 42,053,981 L55Q probably damaging Het
Shc4 T C 2: 125,639,367 D255G probably damaging Het
Skint2 T A 4: 112,625,909 H170Q probably benign Het
Slc29a4 A G 5: 142,717,754 Y261C probably damaging Het
Slc35a5 A T 16: 45,143,708 N102K possibly damaging Het
Slc38a3 A T 9: 107,655,953 I307K probably damaging Het
Sv2b A T 7: 75,124,080 S548T probably benign Het
Tgfbi T C 13: 56,632,881 S524P probably benign Het
Tgm5 T C 2: 121,075,218 D152G probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Ttc22 T C 4: 106,636,806 V321A probably benign Het
Ube2c C A 2: 164,770,023 A15E probably benign Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Umod A T 7: 119,463,255 L631M probably damaging Het
Ush1c G A 7: 46,219,392 Q373* probably null Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Wnt8b T C 19: 44,493,590 L14P probably benign Het
Wrn G A 8: 33,288,864 A563V probably damaging Het
Zfp608 A G 18: 54,897,911 S986P probably benign Het
Znrf3 T C 11: 5,283,373 H228R possibly damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 unclassified probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 64204555 missense probably benign 0.00
R7776:Trpm1 UTSW 7 64248191 missense probably benign 0.04
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGTCTGGCATTCCGTAAACAC -3'
(R):5'- CACTGTTGATGCTGCTCTGC -3'

Sequencing Primer
(F):5'- GTCTGGCATTCCGTAAACACTATATG -3'
(R):5'- TGCCGCAGCAGGTAGGTG -3'
Posted On2014-06-30