Incidental Mutation 'R1864:Epg5'
ID208566
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Nameectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission 039887-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R1864 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location77938467-78035027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77975031 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 919 (L919H)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
Predicted Effect probably damaging
Transcript: ENSMUST00000044622
AA Change: L919H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: L919H

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agtpbp1 A G 13: 59,450,202 Y1198H possibly damaging Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
AI314180 T A 4: 58,849,942 H427L possibly damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ankrd50 A T 3: 38,454,461 N329K probably benign Het
Ano4 C A 10: 88,971,391 G741V probably damaging Het
Anxa1 T C 19: 20,379,689 D191G probably benign Het
Apc2 C T 10: 80,313,648 T1512I probably damaging Het
Aph1b A T 9: 66,794,113 C81S probably benign Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Arhgef28 A T 13: 97,994,132 H399Q probably benign Het
Asic5 A G 3: 82,011,987 E304G probably benign Het
B4galnt4 A G 7: 141,070,533 Y771C probably damaging Het
Birc2 G T 9: 7,819,517 Q465K probably benign Het
Btla C T 16: 45,250,374 T232I probably damaging Het
Ccdc84 A G 9: 44,417,721 C66R probably damaging Het
Ccl7 G T 11: 82,046,552 K37N probably benign Het
Cdk17 T C 10: 93,226,105 V233A probably damaging Het
Cilp2 C A 8: 69,881,323 Q1008H probably damaging Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Clcnka T C 4: 141,392,802 T269A probably damaging Het
Col12a1 A T 9: 79,627,103 probably null Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cyp3a25 T C 5: 145,994,929 D123G probably damaging Het
D630003M21Rik A T 2: 158,203,185 L808Q probably damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx15 T C 5: 52,184,701 T92A possibly damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Diaph2 G A X: 129,960,127 R473Q probably damaging Het
Dnd1 A G 18: 36,766,004 C11R possibly damaging Het
Dock1 A C 7: 135,146,507 D1566A probably benign Het
Drp2 A G X: 134,427,115 I43V probably benign Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Emilin1 A G 5: 30,918,590 E725G probably damaging Het
Eml2 A G 7: 19,201,878 Y487C probably damaging Het
Fam187a T A 11: 102,886,011 S214T probably damaging Het
Flna T C X: 74,240,263 T521A probably benign Het
Foxi1 T A 11: 34,207,531 I165F probably damaging Het
Fxr2 A T 11: 69,652,277 K633N probably benign Het
Gdpd5 T C 7: 99,448,999 I209T probably benign Het
Gm13212 A T 4: 145,622,428 Q145L possibly damaging Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Grm7 A T 6: 111,080,423 D328V probably benign Het
Heatr6 T C 11: 83,769,230 S534P probably damaging Het
Heph A G X: 96,529,486 T792A probably damaging Het
Hipk2 T A 6: 38,718,935 probably null Het
Hps3 T A 3: 20,019,959 probably null Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Insc T C 7: 114,842,178 I409T probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Kcnma1 T A 14: 23,803,162 Q108L probably damaging Het
Klc3 A G 7: 19,398,041 V137A probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Lgr4 T A 2: 110,011,397 F576I possibly damaging Het
Lypd6b A G 2: 49,947,447 I144V possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Mitf A T 6: 98,010,422 N159I probably damaging Het
Morc1 T C 16: 48,592,530 I678T probably benign Het
Muc4 A G 16: 32,756,251 probably benign Het
Myo7a T C 7: 98,052,256 Y2115C probably damaging Het
Myof T C 19: 37,986,705 I182V probably benign Het
Ncor1 A G 11: 62,381,419 V635A probably damaging Het
Neb G T 2: 52,212,760 Y4257* probably null Het
Npr2 T A 4: 43,641,258 V428E probably benign Het
Nufip2 A G 11: 77,692,298 D346G probably damaging Het
Obsl1 G A 1: 75,493,109 S1088F probably benign Het
Olfr1262 T A 2: 90,002,481 V25E probably benign Het
Olfr1282 C T 2: 111,335,707 V124M possibly damaging Het
Olfr204 A G 16: 59,315,015 Y131H probably damaging Het
Olfr705 T C 7: 106,713,823 N286S possibly damaging Het
Olfr877 T A 9: 37,855,264 Y149N probably damaging Het
Olfr982 T G 9: 40,074,785 I163M possibly damaging Het
Pdgfrb G A 18: 61,071,717 V550I probably benign Het
Pi4ka A T 16: 17,367,525 L237* probably null Het
Pla2r1 G A 2: 60,428,711 T1111M probably benign Het
Plxnd1 A T 6: 115,969,441 probably null Het
Pnp G C 14: 50,947,973 A67P probably benign Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prom2 T C 2: 127,539,787 D203G probably benign Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rnf115 A G 3: 96,727,837 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rusc2 C A 4: 43,421,719 A713D possibly damaging Het
Ryr3 A T 2: 112,730,328 H3009Q possibly damaging Het
Serpina1d C A 12: 103,767,997 C16F probably benign Het
Serpinf2 G T 11: 75,437,483 R80S possibly damaging Het
Sh2d4a C A 8: 68,329,315 Q192K probably benign Het
Sh3d21 T A 4: 126,150,936 probably null Het
Sh3rf2 T A 18: 42,053,981 L55Q probably damaging Het
Shc4 T C 2: 125,639,367 D255G probably damaging Het
Skint2 T A 4: 112,625,909 H170Q probably benign Het
Slc29a4 A G 5: 142,717,754 Y261C probably damaging Het
Slc35a5 A T 16: 45,143,708 N102K possibly damaging Het
Slc38a3 A T 9: 107,655,953 I307K probably damaging Het
Sv2b A T 7: 75,124,080 S548T probably benign Het
Tgfbi T C 13: 56,632,881 S524P probably benign Het
Tgm5 T C 2: 121,075,218 D152G probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Trpm1 A G 7: 64,268,016 K1258R probably damaging Het
Ttc22 T C 4: 106,636,806 V321A probably benign Het
Ube2c C A 2: 164,770,023 A15E probably benign Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Umod A T 7: 119,463,255 L631M probably damaging Het
Ush1c G A 7: 46,219,392 Q373* probably null Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Wnt8b T C 19: 44,493,590 L14P probably benign Het
Wrn G A 8: 33,288,864 A563V probably damaging Het
Zfp608 A G 18: 54,897,911 S986P probably benign Het
Znrf3 T C 11: 5,283,373 H228R possibly damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
R7586:Epg5 UTSW 18 78030060 missense probably benign
R7651:Epg5 UTSW 18 77981400 nonsense probably null
R7715:Epg5 UTSW 18 77968586 missense probably damaging 1.00
R7753:Epg5 UTSW 18 77948345 missense possibly damaging 0.92
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTTCTGAATCCAGTGTCCTG -3'
(R):5'- ACTCATGCCAAATTCTGAAACACTG -3'

Sequencing Primer
(F):5'- GAATCCAGTGTCCTGCTTTACTG -3'
(R):5'- ATTTCGAGGCCAAACTGGTC -3'
Posted On2014-06-30