Incidental Mutation 'R0117:Xirp2'
ID 20857
Institutional Source Beutler Lab
Gene Symbol Xirp2
Ensembl Gene ENSMUSG00000027022
Gene Name xin actin-binding repeat containing 2
Synonyms 2310003D02Rik, 2310008C07Rik, myomaxin, Cmya3, A530024P18Rik, mXin beta
MMRRC Submission 038403-MU
Accession Numbers

Genbank: NM_001024618, NM_001083919; MGI: 2685198
Essential gene? Possibly non essential (E-score: 0.405) question?
Stock # R0117 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 2
Chromosomal Location 67446002-67526614 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 67517120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 3235 (A3235V)
Ref Sequence ENSEMBL: ENSMUSP00000107966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000028410
AA Change: A3235V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: A3235V

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4e-9 PFAM
Pfam:Xin 384 398 7.6e-10 PFAM
Pfam:Xin 420 435 6.4e-9 PFAM
Pfam:Xin 458 473 5.3e-9 PFAM
Pfam:Xin 536 551 4.1e-12 PFAM
Pfam:Xin 574 588 2.1e-8 PFAM
Pfam:Xin 609 623 6e-9 PFAM
Pfam:Xin 642 656 5.6e-8 PFAM
Pfam:Xin 679 693 5.9e-8 PFAM
Pfam:Xin 784 799 1.1e-10 PFAM
Pfam:Xin 822 837 3.9e-11 PFAM
Pfam:Xin 861 875 8.6e-12 PFAM
Pfam:Xin 894 909 2.8e-10 PFAM
Pfam:Xin 1006 1021 3.1e-9 PFAM
Pfam:Xin 1079 1094 6.7e-10 PFAM
Pfam:Xin 1117 1132 1.5e-10 PFAM
Pfam:Xin 1154 1169 2.4e-8 PFAM
Pfam:Xin 1256 1271 4.6e-8 PFAM
Pfam:Xin 1292 1305 1.6e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
LIM 3256 3308 4.45e-12 SMART
low complexity region 3356 3367 N/A INTRINSIC
low complexity region 3549 3565 N/A INTRINSIC
low complexity region 3614 3625 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112347
AA Change: A3235V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: A3235V

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4.3e-8 PFAM
Pfam:Xin 383 398 6.9e-9 PFAM
Pfam:Xin 420 435 1.8e-8 PFAM
Pfam:Xin 458 473 6.9e-8 PFAM
Pfam:Xin 536 551 2.8e-10 PFAM
Pfam:Xin 608 623 2.4e-8 PFAM
Pfam:Xin 642 657 1.7e-7 PFAM
Pfam:Xin 784 799 3.5e-9 PFAM
Pfam:Xin 822 837 8.9e-10 PFAM
Pfam:Xin 861 876 3.9e-10 PFAM
Pfam:Xin 894 909 5.4e-9 PFAM
Pfam:Xin 1006 1021 6.2e-8 PFAM
Pfam:Xin 1079 1094 2.4e-8 PFAM
Pfam:Xin 1117 1132 9.5e-9 PFAM
Pfam:Xin 1291 1306 5.8e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142314
Meta Mutation Damage Score 0.1708 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype Strain: 4947971; 4453315
Lethality: D3-D21
PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Xirp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Xirp2 APN 2 67513375 missense probably benign 0.37
IGL00336:Xirp2 APN 2 67512598 missense possibly damaging 0.93
IGL00596:Xirp2 APN 2 67514882 missense probably benign 0.08
IGL00862:Xirp2 APN 2 67516903 missense probably benign 0.00
IGL01124:Xirp2 APN 2 67508615 missense probably damaging 0.99
IGL01289:Xirp2 APN 2 67513181 missense probably damaging 0.99
IGL01293:Xirp2 APN 2 67515184 missense possibly damaging 0.51
IGL01372:Xirp2 APN 2 67513990 missense possibly damaging 0.93
IGL01385:Xirp2 APN 2 67509677 missense probably damaging 0.99
IGL01411:Xirp2 APN 2 67514083 missense probably benign 0.00
IGL01413:Xirp2 APN 2 67509926 missense probably damaging 1.00
IGL01551:Xirp2 APN 2 67513505 missense probably benign
IGL01672:Xirp2 APN 2 67508502 missense probably benign
IGL01724:Xirp2 APN 2 67526067 missense probably benign
IGL01739:Xirp2 APN 2 67515138 missense probably benign 0.15
IGL01807:Xirp2 APN 2 67515031 missense probably benign
IGL02006:Xirp2 APN 2 67511962 missense possibly damaging 0.85
IGL02030:Xirp2 APN 2 67508981 missense probably benign 0.06
IGL02066:Xirp2 APN 2 67526071 missense probably benign
IGL02138:Xirp2 APN 2 67516956 missense probably benign 0.15
IGL02250:Xirp2 APN 2 67514012 missense probably benign 0.03
IGL02265:Xirp2 APN 2 67517150 missense possibly damaging 0.94
IGL02274:Xirp2 APN 2 67508651 missense probably benign 0.12
IGL02322:Xirp2 APN 2 67508738 missense probably benign 0.00
IGL02327:Xirp2 APN 2 67510100 missense probably damaging 1.00
IGL02378:Xirp2 APN 2 67513768 missense probably benign 0.00
IGL02492:Xirp2 APN 2 67516167 missense probably damaging 0.99
IGL02549:Xirp2 APN 2 67513102 missense probably benign 0.03
IGL02578:Xirp2 APN 2 67511247 missense probably damaging 0.96
IGL02635:Xirp2 APN 2 67507910 missense possibly damaging 0.86
IGL02654:Xirp2 APN 2 67514671 missense possibly damaging 0.86
IGL02663:Xirp2 APN 2 67509458 missense possibly damaging 0.92
IGL02795:Xirp2 APN 2 67509136 missense probably damaging 1.00
IGL02934:Xirp2 APN 2 67515676 missense probably benign 0.33
IGL03003:Xirp2 APN 2 67515562 missense possibly damaging 0.93
IGL03069:Xirp2 APN 2 67509532 missense possibly damaging 0.91
IGL03286:Xirp2 APN 2 67516310 missense probably damaging 0.99
IGL03326:Xirp2 APN 2 67482246 missense probably benign 0.01
IGL03381:Xirp2 APN 2 67514226 missense probably benign 0.34
IGL03394:Xirp2 APN 2 67515194 missense probably damaging 0.99
Ordovician UTSW 2 67482363 missense possibly damaging 0.72
silurian UTSW 2 67519265 missense probably damaging 0.99
3-1:Xirp2 UTSW 2 67508198 missense possibly damaging 0.95
H8562:Xirp2 UTSW 2 67515457 missense probably benign
PIT4142001:Xirp2 UTSW 2 67519362 splice site probably benign
PIT4260001:Xirp2 UTSW 2 67511597 missense possibly damaging 0.96
PIT4445001:Xirp2 UTSW 2 67509772 missense possibly damaging 0.84
PIT4531001:Xirp2 UTSW 2 67515482 missense possibly damaging 0.73
R0015:Xirp2 UTSW 2 67510899 nonsense probably null
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0066:Xirp2 UTSW 2 67512140 missense possibly damaging 0.85
R0109:Xirp2 UTSW 2 67519278 missense probably damaging 1.00
R0111:Xirp2 UTSW 2 67508378 missense probably damaging 0.99
R0115:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0133:Xirp2 UTSW 2 67517124 missense probably benign
R0282:Xirp2 UTSW 2 67513380 missense probably damaging 0.96
R0463:Xirp2 UTSW 2 67514918 missense probably benign 0.02
R0481:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0488:Xirp2 UTSW 2 67514821 missense possibly damaging 0.90
R0548:Xirp2 UTSW 2 67514414 missense probably benign 0.00
R0557:Xirp2 UTSW 2 67516351 missense probably benign 0.33
R0582:Xirp2 UTSW 2 67508866 missense probably benign
R0723:Xirp2 UTSW 2 67512215 missense probably damaging 0.98
R0835:Xirp2 UTSW 2 67507910 missense possibly damaging 0.86
R1160:Xirp2 UTSW 2 67509887 missense possibly damaging 0.92
R1189:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R1474:Xirp2 UTSW 2 67525067 missense probably benign 0.00
R1513:Xirp2 UTSW 2 67511530 missense probably benign 0.00
R1514:Xirp2 UTSW 2 67514323 nonsense probably null
R1519:Xirp2 UTSW 2 67515679 missense probably benign 0.44
R1532:Xirp2 UTSW 2 67513939 missense probably benign 0.00
R1537:Xirp2 UTSW 2 67510013 missense probably damaging 0.98
R1541:Xirp2 UTSW 2 67512290 missense possibly damaging 0.70
R1543:Xirp2 UTSW 2 67508039 missense probably benign
R1607:Xirp2 UTSW 2 67510295 nonsense probably null
R1620:Xirp2 UTSW 2 67510835 missense probably damaging 0.98
R1709:Xirp2 UTSW 2 67509871 missense probably benign 0.33
R1713:Xirp2 UTSW 2 67512418 missense probably benign 0.25
R1828:Xirp2 UTSW 2 67515238 missense possibly damaging 0.86
R1834:Xirp2 UTSW 2 67511140 missense probably damaging 0.99
R1905:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1907:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1943:Xirp2 UTSW 2 67512615 missense probably benign 0.34
R1971:Xirp2 UTSW 2 67511695 missense possibly damaging 0.48
R1998:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R2075:Xirp2 UTSW 2 67510201 missense probably benign 0.33
R2132:Xirp2 UTSW 2 67508048 missense possibly damaging 0.72
R2175:Xirp2 UTSW 2 67509914 missense probably damaging 0.99
R2310:Xirp2 UTSW 2 67526247 missense probably benign 0.19
R2338:Xirp2 UTSW 2 67510770 missense probably damaging 0.98
R2426:Xirp2 UTSW 2 67514471 missense probably benign 0.02
R2483:Xirp2 UTSW 2 67524992 missense probably benign
R3084:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R3113:Xirp2 UTSW 2 67510147 missense probably benign 0.33
R3903:Xirp2 UTSW 2 67508036 missense probably benign 0.40
R3916:Xirp2 UTSW 2 67511422 missense probably benign 0.25
R3928:Xirp2 UTSW 2 67511669 missense possibly damaging 0.85
R4025:Xirp2 UTSW 2 67511402 missense probably benign 0.12
R4135:Xirp2 UTSW 2 67525397 missense probably benign 0.00
R4223:Xirp2 UTSW 2 67516493 missense possibly damaging 0.66
R4257:Xirp2 UTSW 2 67516039 missense probably benign 0.31
R4499:Xirp2 UTSW 2 67513438 missense probably benign 0.08
R4577:Xirp2 UTSW 2 67513897 missense probably damaging 0.99
R4739:Xirp2 UTSW 2 67519265 missense probably damaging 0.99
R4758:Xirp2 UTSW 2 67516535 missense probably damaging 0.98
R4834:Xirp2 UTSW 2 67516406 missense probably benign 0.26
R4855:Xirp2 UTSW 2 67511064 missense possibly damaging 0.96
R4923:Xirp2 UTSW 2 67512893 missense probably benign
R4936:Xirp2 UTSW 2 67509819 missense possibly damaging 0.85
R5032:Xirp2 UTSW 2 67525670 missense possibly damaging 0.84
R5049:Xirp2 UTSW 2 67517134 missense probably benign 0.03
R5077:Xirp2 UTSW 2 67514477 missense probably benign
R5090:Xirp2 UTSW 2 67525470 missense possibly damaging 0.83
R5107:Xirp2 UTSW 2 67509710 missense probably damaging 0.99
R5107:Xirp2 UTSW 2 67511861 missense probably damaging 1.00
R5187:Xirp2 UTSW 2 67515367 missense probably benign 0.01
R5241:Xirp2 UTSW 2 67482360 nonsense probably null
R5307:Xirp2 UTSW 2 67511162 missense probably damaging 0.99
R5342:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R5370:Xirp2 UTSW 2 67512152 missense possibly damaging 0.72
R5375:Xirp2 UTSW 2 67511906 missense probably damaging 0.99
R5407:Xirp2 UTSW 2 67510969 missense probably benign 0.33
R5514:Xirp2 UTSW 2 67505121 missense probably benign 0.03
R5531:Xirp2 UTSW 2 67515302 missense probably benign 0.42
R5590:Xirp2 UTSW 2 67514035 missense probably benign 0.23
R5646:Xirp2 UTSW 2 67510790 missense probably damaging 0.99
R5649:Xirp2 UTSW 2 67516895 missense probably benign 0.00
R5686:Xirp2 UTSW 2 67482298 missense probably damaging 0.99
R5761:Xirp2 UTSW 2 67510967 missense probably benign 0.00
R5777:Xirp2 UTSW 2 67510004 missense possibly damaging 0.92
R5785:Xirp2 UTSW 2 67509662 missense probably damaging 0.96
R5843:Xirp2 UTSW 2 67476785 start gained probably benign
R5846:Xirp2 UTSW 2 67509243 missense probably damaging 0.98
R5875:Xirp2 UTSW 2 67505080 missense probably benign 0.00
R5896:Xirp2 UTSW 2 67508698 missense probably benign 0.32
R5896:Xirp2 UTSW 2 67509946 missense possibly damaging 0.91
R5901:Xirp2 UTSW 2 67513066 missense possibly damaging 0.91
R5934:Xirp2 UTSW 2 67524804 missense possibly damaging 0.92
R5950:Xirp2 UTSW 2 67511320 missense possibly damaging 0.95
R5996:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6013:Xirp2 UTSW 2 67510943 missense possibly damaging 0.48
R6048:Xirp2 UTSW 2 67508243 missense possibly damaging 0.96
R6111:Xirp2 UTSW 2 67511817 missense possibly damaging 0.86
R6180:Xirp2 UTSW 2 67505577 critical splice donor site probably null
R6342:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6346:Xirp2 UTSW 2 67516081 missense probably benign 0.00
R6603:Xirp2 UTSW 2 67516544 missense probably benign
R6604:Xirp2 UTSW 2 67509845 missense possibly damaging 0.86
R6669:Xirp2 UTSW 2 67513355 missense possibly damaging 0.78
R6701:Xirp2 UTSW 2 67516225 missense possibly damaging 0.94
R6726:Xirp2 UTSW 2 67512868 missense possibly damaging 0.88
R6833:Xirp2 UTSW 2 67509950 missense probably benign 0.12
R6897:Xirp2 UTSW 2 67508567 missense probably damaging 1.00
R6933:Xirp2 UTSW 2 67514857 missense probably benign 0.34
R7020:Xirp2 UTSW 2 67525569 missense probably benign
R7042:Xirp2 UTSW 2 67513289 missense probably benign 0.12
R7060:Xirp2 UTSW 2 67515608 missense probably damaging 1.00
R7179:Xirp2 UTSW 2 67509833 missense probably benign 0.00
R7229:Xirp2 UTSW 2 67525551 missense probably damaging 0.99
R7253:Xirp2 UTSW 2 67513482 missense probably benign
R7284:Xirp2 UTSW 2 67516829 missense probably benign
R7450:Xirp2 UTSW 2 67509815 missense possibly damaging 0.86
R7476:Xirp2 UTSW 2 67510634 missense probably benign 0.01
R7489:Xirp2 UTSW 2 67525560 missense possibly damaging 0.83
R7513:Xirp2 UTSW 2 67510764 missense possibly damaging 0.86
R7549:Xirp2 UTSW 2 67508897 missense possibly damaging 0.91
R7563:Xirp2 UTSW 2 67509901 missense probably damaging 0.99
R7567:Xirp2 UTSW 2 67515982 missense probably benign 0.02
R7577:Xirp2 UTSW 2 67514965 missense possibly damaging 0.65
R7597:Xirp2 UTSW 2 67525755 missense possibly damaging 0.84
R7610:Xirp2 UTSW 2 67525962 missense possibly damaging 0.92
R7613:Xirp2 UTSW 2 67514498 missense probably benign 0.00
R7669:Xirp2 UTSW 2 67512177 missense probably benign 0.00
R7670:Xirp2 UTSW 2 67510573 missense possibly damaging 0.91
R7673:Xirp2 UTSW 2 67517087 missense probably damaging 1.00
R7682:Xirp2 UTSW 2 67508849 missense probably damaging 0.99
R7755:Xirp2 UTSW 2 67515182 missense probably benign
R7805:Xirp2 UTSW 2 67509981 missense probably benign 0.23
R7815:Xirp2 UTSW 2 67509412 missense probably damaging 1.00
R7823:Xirp2 UTSW 2 67511774 missense probably damaging 1.00
R7842:Xirp2 UTSW 2 67524945 missense probably benign 0.00
R7863:Xirp2 UTSW 2 67512730 missense probably benign 0.03
R7895:Xirp2 UTSW 2 67509497 missense probably damaging 0.96
R7948:Xirp2 UTSW 2 67519314 missense possibly damaging 0.95
R8083:Xirp2 UTSW 2 67508699 missense possibly damaging 0.71
R8125:Xirp2 UTSW 2 67512035 missense probably benign 0.25
R8154:Xirp2 UTSW 2 67511673 missense possibly damaging 0.48
R8169:Xirp2 UTSW 2 67513199 missense probably benign 0.00
R8213:Xirp2 UTSW 2 67476866 missense probably damaging 0.96
R8215:Xirp2 UTSW 2 67516509 missense probably benign 0.08
R8230:Xirp2 UTSW 2 67515665 missense probably damaging 0.99
R8266:Xirp2 UTSW 2 67508574 missense probably damaging 0.98
R8350:Xirp2 UTSW 2 67525369 missense probably benign
R8432:Xirp2 UTSW 2 67510618 missense probably benign
R8441:Xirp2 UTSW 2 67512815 missense possibly damaging 0.85
R8677:Xirp2 UTSW 2 67516634 missense probably damaging 0.98
R8773:Xirp2 UTSW 2 67525183 missense probably benign
R8794:Xirp2 UTSW 2 67511213 missense probably damaging 0.98
R8930:Xirp2 UTSW 2 67482363 missense possibly damaging 0.72
R8932:Xirp2 UTSW 2 67482363 missense possibly damaging 0.72
R8939:Xirp2 UTSW 2 67516144 missense probably benign 0.04
R9263:Xirp2 UTSW 2 67514945 missense possibly damaging 0.76
R9313:Xirp2 UTSW 2 67516978 missense probably damaging 0.99
R9350:Xirp2 UTSW 2 67519309 missense probably damaging 1.00
R9375:Xirp2 UTSW 2 67511774 missense probably damaging 1.00
R9442:Xirp2 UTSW 2 67511891 nonsense probably null
R9447:Xirp2 UTSW 2 67508606 missense probably damaging 0.98
R9457:Xirp2 UTSW 2 67515632 missense probably benign 0.03
R9507:Xirp2 UTSW 2 67513936 missense possibly damaging 0.95
R9529:Xirp2 UTSW 2 67525196 missense possibly damaging 0.93
R9569:Xirp2 UTSW 2 67510898 missense probably damaging 1.00
R9607:Xirp2 UTSW 2 67510762 missense possibly damaging 0.72
R9648:Xirp2 UTSW 2 67516255 missense probably benign
R9651:Xirp2 UTSW 2 67513823 missense possibly damaging 0.72
R9678:Xirp2 UTSW 2 67509444 missense possibly damaging 0.91
R9691:Xirp2 UTSW 2 67510195 missense possibly damaging 0.91
R9777:Xirp2 UTSW 2 67517035 missense possibly damaging 0.85
RF035:Xirp2 UTSW 2 67525544 utr 3 prime probably benign
RF040:Xirp2 UTSW 2 67525544 utr 3 prime probably benign
X0063:Xirp2 UTSW 2 67516123 missense probably benign 0.04
X0065:Xirp2 UTSW 2 67515118 missense probably benign 0.34
Z1088:Xirp2 UTSW 2 67513321 missense probably benign 0.03
Z1176:Xirp2 UTSW 2 67511393 missense probably damaging 0.99
Z1176:Xirp2 UTSW 2 67514579 missense probably benign 0.17
Z1176:Xirp2 UTSW 2 67525232 missense probably damaging 1.00
Z1177:Xirp2 UTSW 2 67510193 frame shift probably null
Z1177:Xirp2 UTSW 2 67525371 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGGGTCAAAGGTAGCAACCTC -3'
(R):5'- GAATCAGAAGCCCTGATGGGTAGC -3'

Sequencing Primer
(F):5'- GGTAGCAACCTCATCATCTCGG -3'
(R):5'- AGCTGTTAGTCCTAGCTTGTTAC -3'
Posted On 2013-04-11