Incidental Mutation 'R1864:Flna'
ID208570
Institutional Source Beutler Lab
Gene Symbol Flna
Ensembl Gene ENSMUSG00000031328
Gene Namefilamin, alpha
SynonymsGENA 379, ABP-280, filamin-1, Dilp2, F730004A14Rik, actin-binding protein 280, Fln1
MMRRC Submission 039887-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R1864 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location74223461-74249820 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74240263 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 521 (T521A)
Ref Sequence ENSEMBL: ENSMUSP00000121082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033699] [ENSMUST00000101454] [ENSMUST00000114299] [ENSMUST00000130007]
Predicted Effect probably benign
Transcript: ENSMUST00000033699
AA Change: T545A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033699
Gene: ENSMUSG00000031328
AA Change: T545A

DomainStartEndE-ValueType
CH 45 147 1.71e-27 SMART
CH 168 264 8.03e-24 SMART
IG_FLMN 280 377 1.08e-32 SMART
IG_FLMN 380 477 1.46e-38 SMART
IG_FLMN 479 573 3.42e-35 SMART
IG_FLMN 575 666 3.94e-26 SMART
IG_FLMN 671 766 1.9e-42 SMART
IG_FLMN 768 869 6.76e-25 SMART
IG_FLMN 871 968 2.96e-30 SMART
IG_FLMN 970 1064 1.66e-24 SMART
IG_FLMN 1066 1157 3.61e-43 SMART
IG_FLMN 1159 1252 3.29e-37 SMART
IG_FLMN 1254 1352 9.92e-32 SMART
IG_FLMN 1354 1445 1.56e-38 SMART
IG_FLMN 1447 1542 3.05e-41 SMART
IG_FLMN 1544 1639 7.8e-39 SMART
IG_FLMN 1641 1743 2.94e-34 SMART
IG_FLMN 1772 1863 9.8e-13 SMART
IG_FLMN 1864 1955 3.69e-40 SMART
IG_FLMN 1956 2042 2.13e-13 SMART
IG_FLMN 2046 2137 9.52e-43 SMART
IG_FLMN 2150 2233 1.61e-8 SMART
IG_FLMN 2237 2328 1.56e-38 SMART
IG_FLMN 2331 2423 3.17e-30 SMART
IG_FLMN 2428 2519 2.11e-35 SMART
IG_FLMN 2556 2647 1.84e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101454
AA Change: T545A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098997
Gene: ENSMUSG00000031328
AA Change: T545A

DomainStartEndE-ValueType
CH 45 147 1.71e-27 SMART
CH 168 264 8.03e-24 SMART
IG_FLMN 280 377 1.08e-32 SMART
IG_FLMN 380 477 1.46e-38 SMART
IG_FLMN 479 573 3.42e-35 SMART
IG_FLMN 575 666 3.94e-26 SMART
IG_FLMN 671 766 1.9e-42 SMART
IG_FLMN 768 869 6.76e-25 SMART
IG_FLMN 871 968 2.96e-30 SMART
IG_FLMN 970 1064 1.66e-24 SMART
IG_FLMN 1066 1157 3.61e-43 SMART
IG_FLMN 1159 1252 3.29e-37 SMART
IG_FLMN 1254 1352 9.92e-32 SMART
IG_FLMN 1354 1445 1.56e-38 SMART
IG_FLMN 1447 1542 3.05e-41 SMART
IG_FLMN 1544 1639 7.8e-39 SMART
IG_FLMN 1641 1735 1.86e-36 SMART
IG_FLMN 1764 1855 9.8e-13 SMART
IG_FLMN 1856 1947 3.69e-40 SMART
IG_FLMN 1948 2034 2.13e-13 SMART
IG_FLMN 2038 2129 9.52e-43 SMART
IG_FLMN 2142 2225 1.61e-8 SMART
IG_FLMN 2229 2320 1.56e-38 SMART
IG_FLMN 2323 2415 3.17e-30 SMART
IG_FLMN 2420 2511 2.11e-35 SMART
IG_FLMN 2548 2639 1.84e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114299
AA Change: T545A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109938
Gene: ENSMUSG00000031328
AA Change: T545A

DomainStartEndE-ValueType
CH 45 147 1.71e-27 SMART
CH 168 264 8.03e-24 SMART
IG_FLMN 280 377 1.08e-32 SMART
IG_FLMN 380 477 1.46e-38 SMART
IG_FLMN 479 573 3.42e-35 SMART
IG_FLMN 575 666 3.94e-26 SMART
IG_FLMN 671 766 1.9e-42 SMART
IG_FLMN 768 869 6.76e-25 SMART
IG_FLMN 871 968 2.96e-30 SMART
IG_FLMN 970 1064 1.66e-24 SMART
IG_FLMN 1066 1157 3.61e-43 SMART
IG_FLMN 1159 1252 3.29e-37 SMART
IG_FLMN 1254 1352 9.92e-32 SMART
IG_FLMN 1354 1445 1.56e-38 SMART
IG_FLMN 1447 1542 3.05e-41 SMART
IG_FLMN 1544 1639 7.8e-39 SMART
IG_FLMN 1641 1735 1.86e-36 SMART
IG_FLMN 1764 1855 9.8e-13 SMART
IG_FLMN 1856 1947 3.69e-40 SMART
IG_FLMN 1948 2034 2.13e-13 SMART
IG_FLMN 2038 2129 9.52e-43 SMART
IG_FLMN 2142 2225 1.61e-8 SMART
IG_FLMN 2229 2320 1.56e-38 SMART
IG_FLMN 2323 2415 3.17e-30 SMART
IG_FLMN 2420 2511 2.11e-35 SMART
IG_FLMN 2548 2639 1.84e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130007
AA Change: T521A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121082
Gene: ENSMUSG00000031328
AA Change: T521A

DomainStartEndE-ValueType
CH 21 123 1.71e-27 SMART
CH 144 240 8.03e-24 SMART
IG_FLMN 256 353 1.08e-32 SMART
IG_FLMN 356 453 1.46e-38 SMART
IG_FLMN 455 549 3.42e-35 SMART
IG_FLMN 551 642 3.94e-26 SMART
IG_FLMN 647 742 1.9e-42 SMART
IG_FLMN 744 845 6.76e-25 SMART
IG_FLMN 847 944 2.96e-30 SMART
IG_FLMN 946 1040 1.66e-24 SMART
IG_FLMN 1042 1133 3.61e-43 SMART
IG_FLMN 1135 1228 3.29e-37 SMART
IG_FLMN 1230 1328 9.92e-32 SMART
IG_FLMN 1330 1421 1.56e-38 SMART
IG_FLMN 1423 1518 3.05e-41 SMART
IG_FLMN 1520 1615 7.8e-39 SMART
IG_FLMN 1617 1711 3.67e-35 SMART
IG_FLMN 1715 1799 1.19e-11 SMART
IG_FLMN 1800 1891 3.69e-40 SMART
IG_FLMN 1892 1978 2.13e-13 SMART
IG_FLMN 1982 2073 9.52e-43 SMART
IG_FLMN 2086 2169 1.61e-8 SMART
IG_FLMN 2173 2264 1.56e-38 SMART
IG_FLMN 2267 2359 3.17e-30 SMART
IG_FLMN 2364 2455 2.11e-35 SMART
IG_FLMN 2492 2583 1.84e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133288
Predicted Effect probably benign
Transcript: ENSMUST00000144429
SMART Domains Protein: ENSMUSP00000123278
Gene: ENSMUSG00000031328

DomainStartEndE-ValueType
CH 33 135 1.71e-27 SMART
CH 156 252 8.03e-24 SMART
IG_FLMN 268 365 1.08e-32 SMART
IG_FLMN 368 465 1.46e-38 SMART
internal_repeat_1 467 510 3.09e-8 PROSPERO
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin-binding protein that crosslinks actin filaments and links actin filaments to membrane glycoproteins. The encoded protein is involved in remodeling the cytoskeleton to effect changes in cell shape and migration. This protein interacts with integrins, transmembrane receptor complexes, and second messengers. Defects in this gene are a cause of several syndromes, including periventricular nodular heterotopias (PVNH1, PVNH4), otopalatodigital syndromes (OPD1, OPD2), frontometaphyseal dysplasia (FMD), Melnick-Needles syndrome (MNS), and X-linked congenital idiopathic intestinal pseudoobstruction (CIIPX). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
PHENOTYPE: Females heterozygous for an X-linked, ENU-induced mutation exhibit dilated pupils and milder cardiac, sternum, and palate defects than males. Hemizygous males are inviable and exhibit incomplete septation of the outflow tract, septal defects, cleft palate and incomplete fusion of the sternum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agtpbp1 A G 13: 59,450,202 Y1198H possibly damaging Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
AI314180 T A 4: 58,849,942 H427L possibly damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ankrd50 A T 3: 38,454,461 N329K probably benign Het
Ano4 C A 10: 88,971,391 G741V probably damaging Het
Anxa1 T C 19: 20,379,689 D191G probably benign Het
Apc2 C T 10: 80,313,648 T1512I probably damaging Het
Aph1b A T 9: 66,794,113 C81S probably benign Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Arhgef28 A T 13: 97,994,132 H399Q probably benign Het
Asic5 A G 3: 82,011,987 E304G probably benign Het
B4galnt4 A G 7: 141,070,533 Y771C probably damaging Het
Birc2 G T 9: 7,819,517 Q465K probably benign Het
Btla C T 16: 45,250,374 T232I probably damaging Het
Ccdc84 A G 9: 44,417,721 C66R probably damaging Het
Ccl7 G T 11: 82,046,552 K37N probably benign Het
Cdk17 T C 10: 93,226,105 V233A probably damaging Het
Cilp2 C A 8: 69,881,323 Q1008H probably damaging Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Clcnka T C 4: 141,392,802 T269A probably damaging Het
Col12a1 A T 9: 79,627,103 probably null Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cyp3a25 T C 5: 145,994,929 D123G probably damaging Het
D630003M21Rik A T 2: 158,203,185 L808Q probably damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx15 T C 5: 52,184,701 T92A possibly damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Diaph2 G A X: 129,960,127 R473Q probably damaging Het
Dnd1 A G 18: 36,766,004 C11R possibly damaging Het
Dock1 A C 7: 135,146,507 D1566A probably benign Het
Drp2 A G X: 134,427,115 I43V probably benign Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Emilin1 A G 5: 30,918,590 E725G probably damaging Het
Eml2 A G 7: 19,201,878 Y487C probably damaging Het
Epg5 T A 18: 77,975,031 L919H probably damaging Het
Fam187a T A 11: 102,886,011 S214T probably damaging Het
Foxi1 T A 11: 34,207,531 I165F probably damaging Het
Fxr2 A T 11: 69,652,277 K633N probably benign Het
Gdpd5 T C 7: 99,448,999 I209T probably benign Het
Gm13212 A T 4: 145,622,428 Q145L possibly damaging Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Grm7 A T 6: 111,080,423 D328V probably benign Het
Heatr6 T C 11: 83,769,230 S534P probably damaging Het
Heph A G X: 96,529,486 T792A probably damaging Het
Hipk2 T A 6: 38,718,935 probably null Het
Hps3 T A 3: 20,019,959 probably null Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Insc T C 7: 114,842,178 I409T probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Kcnma1 T A 14: 23,803,162 Q108L probably damaging Het
Klc3 A G 7: 19,398,041 V137A probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Lgr4 T A 2: 110,011,397 F576I possibly damaging Het
Lypd6b A G 2: 49,947,447 I144V possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Mitf A T 6: 98,010,422 N159I probably damaging Het
Morc1 T C 16: 48,592,530 I678T probably benign Het
Muc4 A G 16: 32,756,251 probably benign Het
Myo7a T C 7: 98,052,256 Y2115C probably damaging Het
Myof T C 19: 37,986,705 I182V probably benign Het
Ncor1 A G 11: 62,381,419 V635A probably damaging Het
Neb G T 2: 52,212,760 Y4257* probably null Het
Npr2 T A 4: 43,641,258 V428E probably benign Het
Nufip2 A G 11: 77,692,298 D346G probably damaging Het
Obsl1 G A 1: 75,493,109 S1088F probably benign Het
Olfr1262 T A 2: 90,002,481 V25E probably benign Het
Olfr1282 C T 2: 111,335,707 V124M possibly damaging Het
Olfr204 A G 16: 59,315,015 Y131H probably damaging Het
Olfr705 T C 7: 106,713,823 N286S possibly damaging Het
Olfr877 T A 9: 37,855,264 Y149N probably damaging Het
Olfr982 T G 9: 40,074,785 I163M possibly damaging Het
Pdgfrb G A 18: 61,071,717 V550I probably benign Het
Pi4ka A T 16: 17,367,525 L237* probably null Het
Pla2r1 G A 2: 60,428,711 T1111M probably benign Het
Plxnd1 A T 6: 115,969,441 probably null Het
Pnp G C 14: 50,947,973 A67P probably benign Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prom2 T C 2: 127,539,787 D203G probably benign Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rnf115 A G 3: 96,727,837 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rusc2 C A 4: 43,421,719 A713D possibly damaging Het
Ryr3 A T 2: 112,730,328 H3009Q possibly damaging Het
Serpina1d C A 12: 103,767,997 C16F probably benign Het
Serpinf2 G T 11: 75,437,483 R80S possibly damaging Het
Sh2d4a C A 8: 68,329,315 Q192K probably benign Het
Sh3d21 T A 4: 126,150,936 probably null Het
Sh3rf2 T A 18: 42,053,981 L55Q probably damaging Het
Shc4 T C 2: 125,639,367 D255G probably damaging Het
Skint2 T A 4: 112,625,909 H170Q probably benign Het
Slc29a4 A G 5: 142,717,754 Y261C probably damaging Het
Slc35a5 A T 16: 45,143,708 N102K possibly damaging Het
Slc38a3 A T 9: 107,655,953 I307K probably damaging Het
Sv2b A T 7: 75,124,080 S548T probably benign Het
Tgfbi T C 13: 56,632,881 S524P probably benign Het
Tgm5 T C 2: 121,075,218 D152G probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Trpm1 A G 7: 64,268,016 K1258R probably damaging Het
Ttc22 T C 4: 106,636,806 V321A probably benign Het
Ube2c C A 2: 164,770,023 A15E probably benign Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Umod A T 7: 119,463,255 L631M probably damaging Het
Ush1c G A 7: 46,219,392 Q373* probably null Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Wnt8b T C 19: 44,493,590 L14P probably benign Het
Wrn G A 8: 33,288,864 A563V probably damaging Het
Zfp608 A G 18: 54,897,911 S986P probably benign Het
Znrf3 T C 11: 5,283,373 H228R possibly damaging Het
Other mutations in Flna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Flna APN X 74229928 missense probably damaging 1.00
IGL02048:Flna APN X 74228500 missense probably benign 0.05
IGL02413:Flna APN X 74241282 missense probably benign 0.01
IGL02620:Flna APN X 74229976 unclassified probably benign
IGL02930:Flna APN X 74223900 missense probably damaging 1.00
IGL02965:Flna APN X 74227210 missense probably damaging 1.00
IGL03218:Flna APN X 74234602 critical splice donor site probably null
R3969:Flna UTSW X 74235667 missense probably damaging 1.00
R3970:Flna UTSW X 74235667 missense probably damaging 1.00
R4084:Flna UTSW X 74236925 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GCCCGAACTTTCTGATTGCC -3'
(R):5'- GTCACTGTAAAGGGTCCCAG -3'

Sequencing Primer
(F):5'- GAACTTTCTGATTGCCACACTCAG -3'
(R):5'- AAAGGGTCCCAGTAAGTTTATCTGG -3'
Posted On2014-06-30