Mutagenetix > Incidental Mutations

Incidental Mutation 'R1865:Lcn2'

208581

Institutional Source

Beutler Lab

Gene Symbol

Lcn2

Ensembl Gene

ENSMUSG00000026822

Gene Name

lipocalin 2

Synonyms

NGAL, 24p3

MMRRC Submission

039888-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1865 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32384633-32388252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32385422 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 194 (T194A)

Ref Sequence

ENSEMBL: ENSMUSP00000053962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048792] [ENSMUST00000050785] [ENSMUST00000146423] [ENSMUST00000192241]

PDB Structure

Crystal Structure of Murine Siderocalin (Lipocalin 2, 24p3) [X-RAY DIFFRACTION]
Crystal Structure of Murine Siderocalin in Complex with an Fab Fragment [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000048792

SMART Domains

Protein: ENSMUSP00000038970
Gene: ENSMUSG00000039195

Domain	Start	End	E-Value	Type
Pfam:UPF0184	1	83	5.5e-46	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000050785
AA Change: T194A

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000053962
Gene: ENSMUSG00000026822
AA Change: T194A

Domain	Start	End	E-Value	Type
Pfam:Lipocalin	48	195	2.2e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136509

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144569

Predicted Effect

probably benign
Transcript: ENSMUST00000146423

SMART Domains

Protein: ENSMUSP00000142021
Gene: ENSMUSG00000039195

Domain	Start	End	E-Value	Type
Pfam:UPF0184	1	43	1.4e-5	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155830

Predicted Effect

probably benign
Transcript: ENSMUST00000192241

SMART Domains

Protein: ENSMUSP00000141430
Gene: ENSMUSG00000026822

Domain	Start	End	E-Value	Type
low complexity region	30	45	N/A	INTRINSIC
Pfam:Lipocalin	134	271	5.3e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192758

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the lipocalin family. Members of this family transport small hydrophobic molecules such as lipids, steroid hormones and retinoids. The protein encoded by this gene is a neutrophil gelatinase-associated lipocalin and plays a role in innate immunity by limiting bacterial growth as a result of sequestering iron-containing siderophores. The presence of this protein in blood and urine is an early biomarker of acute kidney injury. This protein is thought to be be involved in multiple cellular processes, including maintenance of skin homeostasis, and suppression of invasiveness and metastasis. Mice lacking this gene are more susceptible to bacterial infection than wild type mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants are more susceptible to infection with bacteria that utilize enterochelin-type siderophores to acquire iron and impaired thermogenesis. Mice homozygous for another knock-out allele exhibit apoptotic defects in hematopoietic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	A	G	1: 158,969,524		noncoding transcript	Het
Aatk	G	A	11: 120,010,222	T1059M	probably benign	Het
Adgrg2	G	A	X: 160,482,351	M532I	probably benign	Het
Agrn	GCTCT	GCTCTCT	4: 156,166,519		probably null	Het
Ahcyl2	G	A	6: 29,908,355	V575M	probably damaging	Het
Apobr	A	G	7: 126,585,968	D217G	probably benign	Het
Aqp9	A	C	9: 71,112,376	N267K	probably benign	Het
Arap2	A	G	5: 62,698,263	V610A	probably damaging	Het
Arhgap21	T	C	2: 20,861,204	E893G	probably damaging	Het
Atn1	T	C	6: 124,745,296		probably benign	Het
Bcl7a	A	T	5: 123,355,969	D68V	probably damaging	Het
Cbl	A	C	9: 44,164,165	C394W	probably damaging	Het
Ccdc18	T	A	5: 108,193,802	D854E	probably benign	Het
Ccdc93	A	T	1: 121,499,227	E580V	probably damaging	Het
Cd180	T	A	13: 102,706,009	M521K	probably benign	Het
Cd300ld2	T	G	11: 115,012,618		probably benign	Het
Cdh10	T	C	15: 18,899,604	F6L	probably benign	Het
Cep78	A	G	19: 15,956,004	S737P	probably damaging	Het
Ces1f	G	T	8: 93,274,265		probably benign	Het
Clcn1	T	A	6: 42,305,541	D442E	probably damaging	Het
Col20a1	T	C	2: 181,015,813	L1250P	possibly damaging	Het
Crispld2	G	A	8: 120,010,567	G19E	probably benign	Het
Ctbp2	C	T	7: 132,990,554	A849T	probably benign	Het
Cts6	A	G	13: 61,201,579	I105T	probably benign	Het
Cul4a	A	G	8: 13,142,589	T617A	possibly damaging	Het
Cyp2c68	G	T	19: 39,734,289	R272S	probably benign	Het
Cystm1	A	G	18: 36,366,676	Y48C	unknown	Het
Dach1	T	A	14: 97,840,209	R579S	possibly damaging	Het
Ddrgk1	A	T	2: 130,654,295	I270N	probably damaging	Het
Dhx32	A	T	7: 133,737,296	C197S	probably benign	Het
Dnah10	A	C	5: 124,832,526		probably null	Het
Ecm2	T	C	13: 49,530,145	V533A	probably benign	Het
Eif4g1	A	G	16: 20,678,648	T202A	probably damaging	Het
Ephb4	A	T	5: 137,363,310	Q525L	possibly damaging	Het
F2	T	C	2: 91,635,194	D82G	probably benign	Het
Fam184b	G	T	5: 45,531,889	N868K	possibly damaging	Het
Fbxo25	A	G	8: 13,935,248	T314A	probably damaging	Het
Folh1	A	G	7: 86,725,906	M624T	possibly damaging	Het
Gabra5	G	A	7: 57,489,192	R71*	probably null	Het
Gmpr	G	T	13: 45,542,625	V278F	probably damaging	Het
Hmcn1	A	T	1: 150,603,812	C4634S	probably damaging	Het
Hspa5	T	C	2: 34,774,541	F336L	probably damaging	Het
Igfbp4	G	A	11: 99,041,686	G64R	probably damaging	Het
Itch	G	A	2: 155,168,746	V45I	probably damaging	Het
Itgb1	T	A	8: 128,720,457	F484L	probably benign	Het
Itpr3	A	G	17: 27,120,023	I2593V	probably benign	Het
Kcnj8	T	A	6: 142,570,240	H47L	probably damaging	Het
Mast4	A	T	13: 102,794,117	V209D	probably damaging	Het
Matn3	T	A	12: 8,952,041	D84E	probably damaging	Het
Mcm7	T	A	5: 138,170,375	Q18L	possibly damaging	Het
Mctp1	G	A	13: 76,385,148	C205Y	possibly damaging	Het
Megf11	A	G	9: 64,680,299	T460A	probably benign	Het
Mlh1	A	T	9: 111,257,024		probably benign	Het
Mylk	T	A	16: 34,912,230	S627T	probably benign	Het
Nat2	A	G	8: 67,501,552	M105V	possibly damaging	Het
Nav2	A	G	7: 49,548,195	T2A	possibly damaging	Het
Ndst3	A	T	3: 123,671,471	I284N	probably damaging	Het
Nfix	A	G	8: 84,772,275	V23A	possibly damaging	Het
Nr2f1	T	C	13: 78,189,926	Y200C	probably damaging	Het
Olfr117	T	C	17: 37,659,863	I157V	possibly damaging	Het
Olfr304	T	C	7: 86,386,561	Y33C	probably damaging	Het
Olfr52	T	G	2: 86,181,538	D191A	probably damaging	Het
Olfr524	G	A	7: 140,202,372	R133C	probably damaging	Het
Olfr933	T	C	9: 38,975,904	V76A	probably benign	Het
Pcdhb21	T	C	18: 37,514,595	V259A	possibly damaging	Het
Phip	A	T	9: 82,945,792	V127E	probably damaging	Het
Pik3r5	A	G	11: 68,492,492	D379G	probably damaging	Het
Pkdrej	A	T	15: 85,820,324	C470*	probably null	Het
Plxnd1	A	T	6: 115,969,441		probably null	Het
Polr1a	G	A	6: 71,966,524	V1248I	probably damaging	Het
Pou3f2	A	T	4: 22,486,917	C405*	probably null	Het
Ppp1r3a	A	T	6: 14,718,405	S837T	probably damaging	Het
Rest	T	A	5: 77,280,898	V388E	probably damaging	Het
Rnft2	A	T	5: 118,232,475	W220R	probably damaging	Het
Rnpc3	A	T	3: 113,621,910	Y107*	probably null	Het
Senp8	G	A	9: 59,737,552	S94F	probably damaging	Het
Ski	A	G	4: 155,222,241	S94P	possibly damaging	Het
Skint8	A	G	4: 111,936,995	D194G	probably damaging	Het
Slc35c2	C	A	2: 165,278,383	R232L	probably benign	Het
Slc43a3	T	A	2: 84,946,901	V198D	possibly damaging	Het
Slc8b1	A	T	5: 120,529,652	N467I	probably damaging	Het
Srbd1	A	G	17: 86,115,304		probably benign	Het
Sstr3	T	C	15: 78,539,968	H193R	probably damaging	Het
Sv2c	A	C	13: 95,976,775	S555R	probably benign	Het
Tagln3	A	G	16: 45,711,650	V173A	possibly damaging	Het
Tctn2	C	A	5: 124,619,080		noncoding transcript	Het
Tfap2a	G	T	13: 40,728,408	H167Q	probably damaging	Het
Tmem213	A	G	6: 38,109,552	T48A	possibly damaging	Het
Tmem30c	A	G	16: 57,269,989		probably benign	Het
Tmem37	A	G	1: 120,068,222	S42P	probably damaging	Het
Tnxb	C	T	17: 34,703,457	Q2415*	probably null	Het
Ttyh1	T	C	7: 4,119,731	L26P	probably damaging	Het
Ubn2	T	A	6: 38,440,490	D154E	possibly damaging	Het
Vdac3	A	T	8: 22,580,537	Y119*	probably null	Het
Vmn2r58	T	C	7: 41,837,258	I738V	possibly damaging	Het
Zfp704	A	G	3: 9,474,491		probably benign	Het
Znfx1	G	A	2: 167,038,809	R352W	probably damaging	Het

Other mutations in Lcn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00935:Lcn2	APN	2	32387578	critical splice donor site	probably null
IGL01327:Lcn2	APN	2	32386018	missense	possibly damaging	0.62
IGL01913:Lcn2	APN	2	32387145	missense	possibly damaging	0.46
IGL02108:Lcn2	APN	2	32387605	missense	probably damaging	0.99
IGL02215:Lcn2	APN	2	32384865	makesense	probably null
IGL02577:Lcn2	APN	2	32387089	missense	probably damaging	0.97
IGL03129:Lcn2	APN	2	32387704	missense	possibly damaging	0.70
R0302:Lcn2	UTSW	2	32384889	unclassified	probably benign
R1864:Lcn2	UTSW	2	32385422	missense	possibly damaging	0.77
R4093:Lcn2	UTSW	2	32387716	start codon destroyed	probably null	1.00
R4621:Lcn2	UTSW	2	32384643	unclassified	probably benign
R5236:Lcn2	UTSW	2	32385961	missense	probably benign	0.06
R5716:Lcn2	UTSW	2	32385813	missense	possibly damaging	0.88
R6785:Lcn2	UTSW	2	32387027	critical splice donor site	probably null
R7059:Lcn2	UTSW	2	32387596	missense	possibly damaging	0.85
R7514:Lcn2	UTSW	2	32387849	critical splice donor site	probably null
R7596:Lcn2	UTSW	2	32385709	missense	probably damaging	1.00
R7694:Lcn2	UTSW	2	32388030	missense	unknown
R7778:Lcn2	UTSW	2	32387915	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATCTGGACTCCTCATCAGGGC -3'
(R):5'- CAAGGAGTGGTCTTCTGCAG -3'

Sequencing Primer
(F):5'- CAAGTCCTGACTGAGATCGCTGAG -3'
(R):5'- GTCTTCTGCAGACCTCCACAG -3'

Posted On

2014-06-30