Incidental Mutation 'R1865:Col20a1'
ID208590
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Namecollagen, type XX, alpha 1
Synonyms1700051I12Rik
MMRRC Submission 039888-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1865 (G1)
Quality Score160
Status Not validated
Chromosome2
Chromosomal Location180986535-181018363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181015813 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1250 (L1250P)
Ref Sequence ENSEMBL: ENSMUSP00000115291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108851] [ENSMUST00000108856] [ENSMUST00000149179] [ENSMUST00000228434]
Predicted Effect probably benign
Transcript: ENSMUST00000108851
SMART Domains Protein: ENSMUSP00000104479
Gene: ENSMUSG00000027577

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 8.4e-79 PFAM
Pfam:Neur_chan_memb 252 620 3.3e-112 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108856
AA Change: L1324P

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356
AA Change: L1324P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149179
AA Change: L1250P

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356
AA Change: L1250P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155425
SMART Domains Protein: ENSMUSP00000114654
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
Pfam:Collagen 1 55 4.9e-12 PFAM
Pfam:Collagen 36 94 2.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198922
Predicted Effect possibly damaging
Transcript: ENSMUST00000228434
AA Change: L1282P

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (99/101)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik A G 1: 158,969,524 noncoding transcript Het
Aatk G A 11: 120,010,222 T1059M probably benign Het
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
Apobr A G 7: 126,585,968 D217G probably benign Het
Aqp9 A C 9: 71,112,376 N267K probably benign Het
Arap2 A G 5: 62,698,263 V610A probably damaging Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Atn1 T C 6: 124,745,296 probably benign Het
Bcl7a A T 5: 123,355,969 D68V probably damaging Het
Cbl A C 9: 44,164,165 C394W probably damaging Het
Ccdc18 T A 5: 108,193,802 D854E probably benign Het
Ccdc93 A T 1: 121,499,227 E580V probably damaging Het
Cd180 T A 13: 102,706,009 M521K probably benign Het
Cd300ld2 T G 11: 115,012,618 probably benign Het
Cdh10 T C 15: 18,899,604 F6L probably benign Het
Cep78 A G 19: 15,956,004 S737P probably damaging Het
Ces1f G T 8: 93,274,265 probably benign Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Crispld2 G A 8: 120,010,567 G19E probably benign Het
Ctbp2 C T 7: 132,990,554 A849T probably benign Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cul4a A G 8: 13,142,589 T617A possibly damaging Het
Cyp2c68 G T 19: 39,734,289 R272S probably benign Het
Cystm1 A G 18: 36,366,676 Y48C unknown Het
Dach1 T A 14: 97,840,209 R579S possibly damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Dnah10 A C 5: 124,832,526 probably null Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Eif4g1 A G 16: 20,678,648 T202A probably damaging Het
Ephb4 A T 5: 137,363,310 Q525L possibly damaging Het
F2 T C 2: 91,635,194 D82G probably benign Het
Fam184b G T 5: 45,531,889 N868K possibly damaging Het
Fbxo25 A G 8: 13,935,248 T314A probably damaging Het
Folh1 A G 7: 86,725,906 M624T possibly damaging Het
Gabra5 G A 7: 57,489,192 R71* probably null Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Hmcn1 A T 1: 150,603,812 C4634S probably damaging Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Igfbp4 G A 11: 99,041,686 G64R probably damaging Het
Itch G A 2: 155,168,746 V45I probably damaging Het
Itgb1 T A 8: 128,720,457 F484L probably benign Het
Itpr3 A G 17: 27,120,023 I2593V probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Mast4 A T 13: 102,794,117 V209D probably damaging Het
Matn3 T A 12: 8,952,041 D84E probably damaging Het
Mcm7 T A 5: 138,170,375 Q18L possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Megf11 A G 9: 64,680,299 T460A probably benign Het
Mlh1 A T 9: 111,257,024 probably benign Het
Mylk T A 16: 34,912,230 S627T probably benign Het
Nat2 A G 8: 67,501,552 M105V possibly damaging Het
Nav2 A G 7: 49,548,195 T2A possibly damaging Het
Ndst3 A T 3: 123,671,471 I284N probably damaging Het
Nfix A G 8: 84,772,275 V23A possibly damaging Het
Nr2f1 T C 13: 78,189,926 Y200C probably damaging Het
Olfr117 T C 17: 37,659,863 I157V possibly damaging Het
Olfr304 T C 7: 86,386,561 Y33C probably damaging Het
Olfr52 T G 2: 86,181,538 D191A probably damaging Het
Olfr524 G A 7: 140,202,372 R133C probably damaging Het
Olfr933 T C 9: 38,975,904 V76A probably benign Het
Pcdhb21 T C 18: 37,514,595 V259A possibly damaging Het
Phip A T 9: 82,945,792 V127E probably damaging Het
Pik3r5 A G 11: 68,492,492 D379G probably damaging Het
Pkdrej A T 15: 85,820,324 C470* probably null Het
Plxnd1 A T 6: 115,969,441 probably null Het
Polr1a G A 6: 71,966,524 V1248I probably damaging Het
Pou3f2 A T 4: 22,486,917 C405* probably null Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Rest T A 5: 77,280,898 V388E probably damaging Het
Rnft2 A T 5: 118,232,475 W220R probably damaging Het
Rnpc3 A T 3: 113,621,910 Y107* probably null Het
Senp8 G A 9: 59,737,552 S94F probably damaging Het
Ski A G 4: 155,222,241 S94P possibly damaging Het
Skint8 A G 4: 111,936,995 D194G probably damaging Het
Slc35c2 C A 2: 165,278,383 R232L probably benign Het
Slc43a3 T A 2: 84,946,901 V198D possibly damaging Het
Slc8b1 A T 5: 120,529,652 N467I probably damaging Het
Srbd1 A G 17: 86,115,304 probably benign Het
Sstr3 T C 15: 78,539,968 H193R probably damaging Het
Sv2c A C 13: 95,976,775 S555R probably benign Het
Tagln3 A G 16: 45,711,650 V173A possibly damaging Het
Tctn2 C A 5: 124,619,080 noncoding transcript Het
Tfap2a G T 13: 40,728,408 H167Q probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem30c A G 16: 57,269,989 probably benign Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Tnxb C T 17: 34,703,457 Q2415* probably null Het
Ttyh1 T C 7: 4,119,731 L26P probably damaging Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Vdac3 A T 8: 22,580,537 Y119* probably null Het
Vmn2r58 T C 7: 41,837,258 I738V possibly damaging Het
Zfp704 A G 3: 9,474,491 probably benign Het
Znfx1 G A 2: 167,038,809 R352W probably damaging Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 181003479 missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180992478 missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180999766 missense probably damaging 0.99
IGL01388:Col20a1 APN 2 181003471 missense probably benign 0.24
IGL01472:Col20a1 APN 2 181007832 missense probably benign 0.44
IGL01936:Col20a1 APN 2 181009368 splice site probably benign
IGL02133:Col20a1 APN 2 181007144 missense probably damaging 1.00
IGL02318:Col20a1 APN 2 181007159 missense probably damaging 0.99
IGL02576:Col20a1 APN 2 181013405 nonsense probably null
IGL02822:Col20a1 APN 2 180996807 missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180989112 nonsense probably null
IGL03056:Col20a1 APN 2 180994889 missense probably damaging 1.00
IGL03189:Col20a1 APN 2 181009407 nonsense probably null
IGL03196:Col20a1 APN 2 181007878 splice site probably null
R0001:Col20a1 UTSW 2 180984412 unclassified probably benign
R0200:Col20a1 UTSW 2 181000438 missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180999162 missense probably benign 0.00
R0964:Col20a1 UTSW 2 180984485 unclassified probably benign
R0975:Col20a1 UTSW 2 181006826 missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180999792 missense probably benign 0.02
R1395:Col20a1 UTSW 2 180998607 missense probably damaging 0.99
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1508:Col20a1 UTSW 2 180992577 missense probably damaging 0.98
R1883:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180998697 missense probably benign 0.00
R2020:Col20a1 UTSW 2 181013163 critical splice donor site probably null
R2121:Col20a1 UTSW 2 180996456 missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180992573 missense probably damaging 1.00
R2343:Col20a1 UTSW 2 181001331 missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 181008593 missense probably damaging 1.00
R3430:Col20a1 UTSW 2 181013285 nonsense probably null
R3547:Col20a1 UTSW 2 180994911 missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180992449 missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180998492 missense probably benign 0.00
R4414:Col20a1 UTSW 2 181001250 missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180992491 missense probably damaging 1.00
R4760:Col20a1 UTSW 2 180984403 unclassified probably benign
R4771:Col20a1 UTSW 2 180989124 missense probably benign 0.17
R4809:Col20a1 UTSW 2 180998661 missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180997363 missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 181006845 missense probably damaging 1.00
R5238:Col20a1 UTSW 2 180998586 missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180986523 unclassified probably null
R6389:Col20a1 UTSW 2 180992583 splice site probably null
R6422:Col20a1 UTSW 2 181014819 missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180996850 missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180996706 missense probably benign 0.00
R7177:Col20a1 UTSW 2 180994214 nonsense probably null
R7195:Col20a1 UTSW 2 181007231 missense probably damaging 1.00
R7717:Col20a1 UTSW 2 181007615 missense probably damaging 1.00
R7872:Col20a1 UTSW 2 180986578 missense probably benign 0.14
R7955:Col20a1 UTSW 2 180986578 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATGAGAAATCAGCTGGGCC -3'
(R):5'- TCAGCCAGAGCAGAGACTTTAC -3'

Sequencing Primer
(F):5'- AAATCAGCTGGGCCCCATCTG -3'
(R):5'- GCCAGAGCAGAGACTTTACAACTTC -3'
Posted On2014-06-30