Incidental Mutation 'R0117:Tgm5'
ID20860
Institutional Source Beutler Lab
Gene Symbol Tgm5
Ensembl Gene ENSMUSG00000053675
Gene Nametransglutaminase 5
Synonyms2310007C07Rik, TGx
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0117 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location121046111-121085841 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 121075102 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028721]
Predicted Effect probably null
Transcript: ENSMUST00000028721
SMART Domains Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675

DomainStartEndE-ValueType
Pfam:Transglut_N 11 127 1.4e-31 PFAM
TGc 275 368 1.86e-49 SMART
Pfam:Transglut_C 511 610 2.5e-23 PFAM
Pfam:Transglut_C 624 722 1.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142674
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Tgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Tgm5 APN 2 121071496 missense probably benign 0.01
IGL01148:Tgm5 APN 2 121046675 splice site probably null
IGL01284:Tgm5 APN 2 121052547 missense possibly damaging 0.94
IGL01370:Tgm5 APN 2 121053537 missense probably benign 0.03
IGL01545:Tgm5 APN 2 121052808 missense probably damaging 1.00
IGL01547:Tgm5 APN 2 121049202 splice site probably benign
IGL01998:Tgm5 APN 2 121052439 missense probably damaging 1.00
IGL02577:Tgm5 APN 2 121077603 missense probably benign 0.01
IGL02636:Tgm5 APN 2 121076796 missense probably damaging 0.99
PIT4283001:Tgm5 UTSW 2 121071585 missense possibly damaging 0.48
R0001:Tgm5 UTSW 2 121077646 missense probably damaging 1.00
R0013:Tgm5 UTSW 2 121076882 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0145:Tgm5 UTSW 2 121077581 missense possibly damaging 0.93
R0356:Tgm5 UTSW 2 121053574 missense probably damaging 1.00
R0410:Tgm5 UTSW 2 121077558 missense possibly damaging 0.46
R0519:Tgm5 UTSW 2 121048895 missense probably damaging 1.00
R1674:Tgm5 UTSW 2 121071544 missense possibly damaging 0.60
R1773:Tgm5 UTSW 2 121077650 missense possibly damaging 0.67
R1864:Tgm5 UTSW 2 121075218 missense probably damaging 1.00
R2276:Tgm5 UTSW 2 121048823 splice site probably benign
R2511:Tgm5 UTSW 2 121076948 missense possibly damaging 0.62
R4180:Tgm5 UTSW 2 121076961 missense probably benign 0.13
R4230:Tgm5 UTSW 2 121070735 missense probably damaging 1.00
R4801:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R4802:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R5840:Tgm5 UTSW 2 121085660 critical splice donor site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R7064:Tgm5 UTSW 2 121053514 missense probably benign 0.04
R7102:Tgm5 UTSW 2 121046498 missense possibly damaging 0.89
R7114:Tgm5 UTSW 2 121048496 nonsense probably null
R7178:Tgm5 UTSW 2 121085768 start gained probably benign
R7748:Tgm5 UTSW 2 121052808 missense probably damaging 1.00
RF022:Tgm5 UTSW 2 121071611 missense probably damaging 1.00
V3553:Tgm5 UTSW 2 121071502 missense probably damaging 1.00
X0065:Tgm5 UTSW 2 121070839 missense probably damaging 1.00
Z1177:Tgm5 UTSW 2 121052451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTGGCATGGCATCATTGAAG -3'
(R):5'- TGGGACTGTTTGGAAAGGAATGCAC -3'

Sequencing Primer
(F):5'- GAAGATTGTTCACCAGCCCTG -3'
(R):5'- GAATGCACAAGGTGGCTTC -3'
Posted On2013-04-11