Mutagenetix > Incidental Mutation

Incidental Mutation 'R1865:Ephb4'

208608

Institutional Source

Beutler Lab

Gene Symbol

Ephb4

Ensembl Gene

ENSMUSG00000029710

Gene Name

Eph receptor B4

Synonyms

MDK2, Htk, Myk1, Tyro11

MMRRC Submission

039888-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1865 (G1)

Quality Score

208

Status

Validated

Chromosome

Chromosomal Location

137350109-137378669 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 137363310 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 525 (Q525L)

Ref Sequence

ENSEMBL: ENSMUSP00000130275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]

AlphaFold

P54761

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061244
AA Change: Q525L

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: Q525L

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111054
AA Change: Q525L

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: Q525L

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	1.4e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	3.4e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
Pfam:SAM_1	882	917	2.6e-7	PFAM
low complexity region	919	934	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111055
AA Change: Q534L

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: Q534L

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	4.2e-10	PFAM
FN3	324	413	1.75e-6	SMART
FN3	443	525	1.07e-10	SMART
Pfam:EphA2_TM	550	621	5e-24	PFAM
TyrKc	624	883	5.09e-130	SMART
SAM	913	980	2.44e-21	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144296
AA Change: Q525L

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: Q525L

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166239
AA Change: Q525L

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: Q525L

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Meta Mutation Damage Score

0.0618

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	A	G	1: 158,969,524		noncoding transcript	Het
Aatk	G	A	11: 120,010,222	T1059M	probably benign	Het
Adgrg2	G	A	X: 160,482,351	M532I	probably benign	Het
Agrn	GCTCT	GCTCTCT	4: 156,166,519		probably null	Het
Ahcyl2	G	A	6: 29,908,355	V575M	probably damaging	Het
Apobr	A	G	7: 126,585,968	D217G	probably benign	Het
Aqp9	A	C	9: 71,112,376	N267K	probably benign	Het
Arap2	A	G	5: 62,698,263	V610A	probably damaging	Het
Arhgap21	T	C	2: 20,861,204	E893G	probably damaging	Het
Atn1	T	C	6: 124,745,296		probably benign	Het
Bcl7a	A	T	5: 123,355,969	D68V	probably damaging	Het
Cbl	A	C	9: 44,164,165	C394W	probably damaging	Het
Ccdc18	T	A	5: 108,193,802	D854E	probably benign	Het
Ccdc93	A	T	1: 121,499,227	E580V	probably damaging	Het
Cd180	T	A	13: 102,706,009	M521K	probably benign	Het
Cd300ld2	T	G	11: 115,012,618		probably benign	Het
Cdh10	T	C	15: 18,899,604	F6L	probably benign	Het
Cep78	A	G	19: 15,956,004	S737P	probably damaging	Het
Ces1f	G	T	8: 93,274,265		probably benign	Het
Clcn1	T	A	6: 42,305,541	D442E	probably damaging	Het
Col20a1	T	C	2: 181,015,813	L1250P	possibly damaging	Het
Crispld2	G	A	8: 120,010,567	G19E	probably benign	Het
Ctbp2	C	T	7: 132,990,554	A849T	probably benign	Het
Cts6	A	G	13: 61,201,579	I105T	probably benign	Het
Cul4a	A	G	8: 13,142,589	T617A	possibly damaging	Het
Cyp2c68	G	T	19: 39,734,289	R272S	probably benign	Het
Cystm1	A	G	18: 36,366,676	Y48C	unknown	Het
Dach1	T	A	14: 97,840,209	R579S	possibly damaging	Het
Ddrgk1	A	T	2: 130,654,295	I270N	probably damaging	Het
Dhx32	A	T	7: 133,737,296	C197S	probably benign	Het
Dnah10	A	C	5: 124,832,526		probably null	Het
Ecm2	T	C	13: 49,530,145	V533A	probably benign	Het
Eif4g1	A	G	16: 20,678,648	T202A	probably damaging	Het
F2	T	C	2: 91,635,194	D82G	probably benign	Het
Fam184b	G	T	5: 45,531,889	N868K	possibly damaging	Het
Fbxo25	A	G	8: 13,935,248	T314A	probably damaging	Het
Folh1	A	G	7: 86,725,906	M624T	possibly damaging	Het
Gabra5	G	A	7: 57,489,192	R71*	probably null	Het
Gmpr	G	T	13: 45,542,625	V278F	probably damaging	Het
Hmcn1	A	T	1: 150,603,812	C4634S	probably damaging	Het
Hspa5	T	C	2: 34,774,541	F336L	probably damaging	Het
Igfbp4	G	A	11: 99,041,686	G64R	probably damaging	Het
Itch	G	A	2: 155,168,746	V45I	probably damaging	Het
Itgb1	T	A	8: 128,720,457	F484L	probably benign	Het
Itpr3	A	G	17: 27,120,023	I2593V	probably benign	Het
Kcnj8	T	A	6: 142,570,240	H47L	probably damaging	Het
Lcn2	T	C	2: 32,385,422	T194A	possibly damaging	Het
Mast4	A	T	13: 102,794,117	V209D	probably damaging	Het
Matn3	T	A	12: 8,952,041	D84E	probably damaging	Het
Mcm7	T	A	5: 138,170,375	Q18L	possibly damaging	Het
Mctp1	G	A	13: 76,385,148	C205Y	possibly damaging	Het
Megf11	A	G	9: 64,680,299	T460A	probably benign	Het
Mlh1	A	T	9: 111,257,024		probably benign	Het
Mylk	T	A	16: 34,912,230	S627T	probably benign	Het
Nat2	A	G	8: 67,501,552	M105V	possibly damaging	Het
Nav2	A	G	7: 49,548,195	T2A	possibly damaging	Het
Ndst3	A	T	3: 123,671,471	I284N	probably damaging	Het
Nfix	A	G	8: 84,772,275	V23A	possibly damaging	Het
Nr2f1	T	C	13: 78,189,926	Y200C	probably damaging	Het
Olfr117	T	C	17: 37,659,863	I157V	possibly damaging	Het
Olfr304	T	C	7: 86,386,561	Y33C	probably damaging	Het
Olfr52	T	G	2: 86,181,538	D191A	probably damaging	Het
Olfr524	G	A	7: 140,202,372	R133C	probably damaging	Het
Olfr933	T	C	9: 38,975,904	V76A	probably benign	Het
Pcdhb21	T	C	18: 37,514,595	V259A	possibly damaging	Het
Phip	A	T	9: 82,945,792	V127E	probably damaging	Het
Pik3r5	A	G	11: 68,492,492	D379G	probably damaging	Het
Pkdrej	A	T	15: 85,820,324	C470*	probably null	Het
Plxnd1	A	T	6: 115,969,441		probably null	Het
Polr1a	G	A	6: 71,966,524	V1248I	probably damaging	Het
Pou3f2	A	T	4: 22,486,917	C405*	probably null	Het
Ppp1r3a	A	T	6: 14,718,405	S837T	probably damaging	Het
Rest	T	A	5: 77,280,898	V388E	probably damaging	Het
Rnft2	A	T	5: 118,232,475	W220R	probably damaging	Het
Rnpc3	A	T	3: 113,621,910	Y107*	probably null	Het
Senp8	G	A	9: 59,737,552	S94F	probably damaging	Het
Ski	A	G	4: 155,222,241	S94P	possibly damaging	Het
Skint8	A	G	4: 111,936,995	D194G	probably damaging	Het
Slc35c2	C	A	2: 165,278,383	R232L	probably benign	Het
Slc43a3	T	A	2: 84,946,901	V198D	possibly damaging	Het
Slc8b1	A	T	5: 120,529,652	N467I	probably damaging	Het
Srbd1	A	G	17: 86,115,304		probably benign	Het
Sstr3	T	C	15: 78,539,968	H193R	probably damaging	Het
Sv2c	A	C	13: 95,976,775	S555R	probably benign	Het
Tagln3	A	G	16: 45,711,650	V173A	possibly damaging	Het
Tctn2	C	A	5: 124,619,080		noncoding transcript	Het
Tfap2a	G	T	13: 40,728,408	H167Q	probably damaging	Het
Tmem213	A	G	6: 38,109,552	T48A	possibly damaging	Het
Tmem30c	A	G	16: 57,269,989		probably benign	Het
Tmem37	A	G	1: 120,068,222	S42P	probably damaging	Het
Tnxb	C	T	17: 34,703,457	Q2415*	probably null	Het
Ttyh1	T	C	7: 4,119,731	L26P	probably damaging	Het
Ubn2	T	A	6: 38,440,490	D154E	possibly damaging	Het
Vdac3	A	T	8: 22,580,537	Y119*	probably null	Het
Vmn2r58	T	C	7: 41,837,258	I738V	possibly damaging	Het
Zfp704	A	G	3: 9,474,491		probably benign	Het
Znfx1	G	A	2: 167,038,809	R352W	probably damaging	Het

Other mutations in Ephb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Ephb4	APN	5	137365615	splice site	probably benign
IGL00948:Ephb4	APN	5	137366659	missense	probably damaging	1.00
IGL01653:Ephb4	APN	5	137365741	splice site	probably benign
IGL01885:Ephb4	APN	5	137357797	missense	probably damaging	1.00
IGL01906:Ephb4	APN	5	137361194	missense	probably damaging	1.00
IGL02089:Ephb4	APN	5	137370762	missense	probably damaging	0.98
IGL02216:Ephb4	APN	5	137372070	missense	possibly damaging	0.92
IGL02233:Ephb4	APN	5	137354501	nonsense	probably null
IGL03080:Ephb4	APN	5	137354083	splice site	probably benign
IGL03111:Ephb4	APN	5	137372505	missense	probably benign	0.07
R0599:Ephb4	UTSW	5	137369855	missense	probably damaging	1.00
R0744:Ephb4	UTSW	5	137365667	missense	probably damaging	1.00
R1331:Ephb4	UTSW	5	137366534	splice site	probably benign
R1441:Ephb4	UTSW	5	137361247	missense	probably damaging	1.00
R1732:Ephb4	UTSW	5	137372178	missense	possibly damaging	0.93
R1745:Ephb4	UTSW	5	137360434	missense	probably benign
R1831:Ephb4	UTSW	5	137354415	missense	probably damaging	1.00
R2165:Ephb4	UTSW	5	137354426	missense	probably benign	0.08
R2206:Ephb4	UTSW	5	137357719	missense	probably damaging	1.00
R2473:Ephb4	UTSW	5	137365700	missense	probably benign	0.15
R4779:Ephb4	UTSW	5	137365702	missense	probably benign	0.04
R4801:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R4802:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R5307:Ephb4	UTSW	5	137363312	missense	probably damaging	1.00
R5452:Ephb4	UTSW	5	137361142	missense	probably damaging	1.00
R5458:Ephb4	UTSW	5	137369852	missense	probably damaging	1.00
R5475:Ephb4	UTSW	5	137354439	missense	probably benign	0.00
R5662:Ephb4	UTSW	5	137372195	missense	probably damaging	0.98
R5879:Ephb4	UTSW	5	137360416	missense	probably benign	0.00
R6336:Ephb4	UTSW	5	137372085	missense	probably damaging	1.00
R6443:Ephb4	UTSW	5	137360449	missense	probably damaging	1.00
R6632:Ephb4	UTSW	5	137366587	missense	probably damaging	0.99
R6973:Ephb4	UTSW	5	137369804	missense	probably damaging	1.00
R7008:Ephb4	UTSW	5	137361274	missense	probably benign	0.00
R7145:Ephb4	UTSW	5	137372046	missense	probably damaging	1.00
R7421:Ephb4	UTSW	5	137354425	missense	possibly damaging	0.88
R7593:Ephb4	UTSW	5	137361298	missense	probably benign
R7635:Ephb4	UTSW	5	137372103	missense	probably damaging	1.00
R7751:Ephb4	UTSW	5	137365675	missense	probably damaging	1.00
R7825:Ephb4	UTSW	5	137372437	missense	probably damaging	1.00
R8539:Ephb4	UTSW	5	137357855	missense	probably damaging	1.00
R8904:Ephb4	UTSW	5	137370805	missense	probably damaging	1.00
R9228:Ephb4	UTSW	5	137354562	missense	possibly damaging	0.79
R9327:Ephb4	UTSW	5	137363267	missense	probably damaging	0.99
R9513:Ephb4	UTSW	5	137363302	missense	possibly damaging	0.76
R9659:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
R9788:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
X0026:Ephb4	UTSW	5	137373558	missense	probably damaging	1.00
Z1177:Ephb4	UTSW	5	137361359	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGGAATCTTACGGCCCATTC -3'
(R):5'- GAGGAGCTTGTGGGTCAACATG -3'

Sequencing Primer
(F):5'- GGAATCTTACGGCCCATTCCTTTC -3'
(R):5'- CTTGTGGGTCAACATGCAGCTAG -3'

Posted On

2014-06-30