Incidental Mutation 'R0117:Ninl'
ID20861
Institutional Source Beutler Lab
Gene Symbol Ninl
Ensembl Gene ENSMUSG00000068115
Gene Nameninein-like
SynonymsLOC381387, LOC381388, 4930519N13Rik
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0117 (G1)
Quality Score153
Status Validated (trace)
Chromosome2
Chromosomal Location150934519-151039382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150937673 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 269 (R269W)
Ref Sequence ENSEMBL: ENSMUSP00000122069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109896] [ENSMUST00000124135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109896
AA Change: R1254W

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115
AA Change: R1254W

DomainStartEndE-ValueType
EFh 12 40 6.56e0 SMART
low complexity region 76 93 N/A INTRINSIC
EFh 201 229 4.45e1 SMART
EFh 238 266 8.98e-4 SMART
low complexity region 295 306 N/A INTRINSIC
coiled coil region 381 423 N/A INTRINSIC
coiled coil region 461 517 N/A INTRINSIC
coiled coil region 541 584 N/A INTRINSIC
coiled coil region 620 699 N/A INTRINSIC
coiled coil region 728 751 N/A INTRINSIC
coiled coil region 835 863 N/A INTRINSIC
coiled coil region 1058 1334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121686
Predicted Effect probably damaging
Transcript: ENSMUST00000124135
AA Change: R269W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122069
Gene: ENSMUSG00000068115
AA Change: R269W

DomainStartEndE-ValueType
coiled coil region 16 61 N/A INTRINSIC
coiled coil region 92 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150036
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit bone-marrow myeloid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Ninl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ninl APN 2 150966241 missense probably damaging 0.98
IGL01697:Ninl APN 2 150939947 missense probably damaging 1.00
IGL01756:Ninl APN 2 150979516 missense probably damaging 1.00
IGL01925:Ninl APN 2 150971059 missense probably damaging 1.00
IGL02341:Ninl APN 2 150944605 nonsense probably null
IGL02838:Ninl APN 2 150955711 splice site probably null
IGL02868:Ninl APN 2 150937054 missense probably benign
IGL03116:Ninl APN 2 150964219 missense probably damaging 1.00
IGL03396:Ninl APN 2 150966212 missense possibly damaging 0.88
R0685:Ninl UTSW 2 150939855 missense possibly damaging 0.73
R0928:Ninl UTSW 2 150963475 missense probably damaging 0.99
R1051:Ninl UTSW 2 150970126 missense probably damaging 1.00
R1441:Ninl UTSW 2 150971124 missense probably benign 0.10
R1493:Ninl UTSW 2 150980095 missense probably damaging 1.00
R1499:Ninl UTSW 2 150980176 missense possibly damaging 0.70
R1539:Ninl UTSW 2 150975947 missense probably damaging 1.00
R1658:Ninl UTSW 2 150964159 missense probably damaging 1.00
R2038:Ninl UTSW 2 150975843 nonsense probably null
R2156:Ninl UTSW 2 150944583 missense probably damaging 1.00
R2232:Ninl UTSW 2 150950050 missense probably benign 0.00
R2373:Ninl UTSW 2 150980117 missense probably damaging 1.00
R3743:Ninl UTSW 2 150950248 missense probably benign 0.01
R3906:Ninl UTSW 2 150980119 missense probably damaging 1.00
R3950:Ninl UTSW 2 150952488 missense possibly damaging 0.90
R4283:Ninl UTSW 2 150953416 unclassified probably benign
R4798:Ninl UTSW 2 150959881 nonsense probably null
R4963:Ninl UTSW 2 150939909 missense probably benign 0.04
R4998:Ninl UTSW 2 150953364 missense probably damaging 1.00
R5343:Ninl UTSW 2 150971190 missense probably benign 0.01
R5810:Ninl UTSW 2 150950168 missense probably benign 0.31
R5825:Ninl UTSW 2 150940724 missense probably damaging 1.00
R6436:Ninl UTSW 2 150966178 missense probably damaging 1.00
R6728:Ninl UTSW 2 150975857 nonsense probably null
R6734:Ninl UTSW 2 150945083 critical splice donor site probably null
R6997:Ninl UTSW 2 150966225 missense probably benign 0.08
R7135:Ninl UTSW 2 150955604 missense probably benign 0.00
R7157:Ninl UTSW 2 150949343 missense possibly damaging 0.63
R7315:Ninl UTSW 2 150950050 missense probably benign 0.00
R7840:Ninl UTSW 2 150966096 missense probably benign 0.00
R7923:Ninl UTSW 2 150966096 missense probably benign 0.00
X0062:Ninl UTSW 2 150970046 missense probably damaging 1.00
Z1177:Ninl UTSW 2 150953398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCACTGATGGCTGACTATGAAG -3'
(R):5'- TGTACATACACAGGCAGGTCCCAC -3'

Sequencing Primer
(F):5'- AGAAACAGCTATGGTCTCTGTCTG -3'
(R):5'- GTCCCACAACACAGGGAGTG -3'
Posted On2013-04-11