Mutagenetix > Incidental Mutations

Incidental Mutation 'R1865:Clcn1'

208614

Institutional Source

Beutler Lab

Gene Symbol

Clcn1

Ensembl Gene

ENSMUSG00000029862

Gene Name

chloride channel, voltage-sensitive 1

Synonyms

Clc1, SMCC1, nmf355, NMF355, Clc-1

MMRRC Submission

039888-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1865 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42286685-42315756 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 42305541 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 442 (D442E)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031894
AA Change: D514E

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: D514E

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	572	3.2e-87	PFAM
Blast:CBS	612	662	1e-24	BLAST
low complexity region	723	747	N/A	INTRINSIC
Blast:CBS	830	877	4e-19	BLAST
low complexity region	928	950	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114684

SMART Domains

Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
Pfam:Voltage_CLC	3	254	2.6e-42	PFAM
CBS	294	344	1.3e1	SMART
low complexity region	405	429	N/A	INTRINSIC
Blast:CBS	480	524	2e-13	BLAST
low complexity region	575	597	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163235

SMART Domains

Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	12	36	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163936
AA Change: D442E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: D442E

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	1.2e-27	PFAM
Pfam:Voltage_CLC	258	501	3.9e-44	PFAM
PDB:2D4Z\|B	520	807	2e-47	PDB
Blast:CBS	541	591	2e-24	BLAST
Blast:CBS	759	806	3e-19	BLAST
low complexity region	857	879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164091

SMART Domains

Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	256	2.9e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165780

SMART Domains

Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	227	9.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168660

SMART Domains

Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	88	97	N/A	INTRINSIC
Pfam:Voltage_CLC	136	257	1.1e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169024

SMART Domains

Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	2.9e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170028

SMART Domains

Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	235	8e-22	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	A	G	1: 158,969,524		noncoding transcript	Het
Aatk	G	A	11: 120,010,222	T1059M	probably benign	Het
Adgrg2	G	A	X: 160,482,351	M532I	probably benign	Het
Agrn	GCTCT	GCTCTCT	4: 156,166,519		probably null	Het
Ahcyl2	G	A	6: 29,908,355	V575M	probably damaging	Het
Apobr	A	G	7: 126,585,968	D217G	probably benign	Het
Aqp9	A	C	9: 71,112,376	N267K	probably benign	Het
Arap2	A	G	5: 62,698,263	V610A	probably damaging	Het
Arhgap21	T	C	2: 20,861,204	E893G	probably damaging	Het
Atn1	T	C	6: 124,745,296		probably benign	Het
Bcl7a	A	T	5: 123,355,969	D68V	probably damaging	Het
Cbl	A	C	9: 44,164,165	C394W	probably damaging	Het
Ccdc18	T	A	5: 108,193,802	D854E	probably benign	Het
Ccdc93	A	T	1: 121,499,227	E580V	probably damaging	Het
Cd180	T	A	13: 102,706,009	M521K	probably benign	Het
Cd300ld2	T	G	11: 115,012,618		probably benign	Het
Cdh10	T	C	15: 18,899,604	F6L	probably benign	Het
Cep78	A	G	19: 15,956,004	S737P	probably damaging	Het
Ces1f	G	T	8: 93,274,265		probably benign	Het
Col20a1	T	C	2: 181,015,813	L1250P	possibly damaging	Het
Crispld2	G	A	8: 120,010,567	G19E	probably benign	Het
Ctbp2	C	T	7: 132,990,554	A849T	probably benign	Het
Cts6	A	G	13: 61,201,579	I105T	probably benign	Het
Cul4a	A	G	8: 13,142,589	T617A	possibly damaging	Het
Cyp2c68	G	T	19: 39,734,289	R272S	probably benign	Het
Cystm1	A	G	18: 36,366,676	Y48C	unknown	Het
Dach1	T	A	14: 97,840,209	R579S	possibly damaging	Het
Ddrgk1	A	T	2: 130,654,295	I270N	probably damaging	Het
Dhx32	A	T	7: 133,737,296	C197S	probably benign	Het
Dnah10	A	C	5: 124,832,526		probably null	Het
Ecm2	T	C	13: 49,530,145	V533A	probably benign	Het
Eif4g1	A	G	16: 20,678,648	T202A	probably damaging	Het
Ephb4	A	T	5: 137,363,310	Q525L	possibly damaging	Het
F2	T	C	2: 91,635,194	D82G	probably benign	Het
Fam184b	G	T	5: 45,531,889	N868K	possibly damaging	Het
Fbxo25	A	G	8: 13,935,248	T314A	probably damaging	Het
Folh1	A	G	7: 86,725,906	M624T	possibly damaging	Het
Gabra5	G	A	7: 57,489,192	R71*	probably null	Het
Gmpr	G	T	13: 45,542,625	V278F	probably damaging	Het
Hmcn1	A	T	1: 150,603,812	C4634S	probably damaging	Het
Hspa5	T	C	2: 34,774,541	F336L	probably damaging	Het
Igfbp4	G	A	11: 99,041,686	G64R	probably damaging	Het
Itch	G	A	2: 155,168,746	V45I	probably damaging	Het
Itgb1	T	A	8: 128,720,457	F484L	probably benign	Het
Itpr3	A	G	17: 27,120,023	I2593V	probably benign	Het
Kcnj8	T	A	6: 142,570,240	H47L	probably damaging	Het
Lcn2	T	C	2: 32,385,422	T194A	possibly damaging	Het
Mast4	A	T	13: 102,794,117	V209D	probably damaging	Het
Matn3	T	A	12: 8,952,041	D84E	probably damaging	Het
Mcm7	T	A	5: 138,170,375	Q18L	possibly damaging	Het
Mctp1	G	A	13: 76,385,148	C205Y	possibly damaging	Het
Megf11	A	G	9: 64,680,299	T460A	probably benign	Het
Mlh1	A	T	9: 111,257,024		probably benign	Het
Mylk	T	A	16: 34,912,230	S627T	probably benign	Het
Nat2	A	G	8: 67,501,552	M105V	possibly damaging	Het
Nav2	A	G	7: 49,548,195	T2A	possibly damaging	Het
Ndst3	A	T	3: 123,671,471	I284N	probably damaging	Het
Nfix	A	G	8: 84,772,275	V23A	possibly damaging	Het
Nr2f1	T	C	13: 78,189,926	Y200C	probably damaging	Het
Olfr117	T	C	17: 37,659,863	I157V	possibly damaging	Het
Olfr304	T	C	7: 86,386,561	Y33C	probably damaging	Het
Olfr52	T	G	2: 86,181,538	D191A	probably damaging	Het
Olfr524	G	A	7: 140,202,372	R133C	probably damaging	Het
Olfr933	T	C	9: 38,975,904	V76A	probably benign	Het
Pcdhb21	T	C	18: 37,514,595	V259A	possibly damaging	Het
Phip	A	T	9: 82,945,792	V127E	probably damaging	Het
Pik3r5	A	G	11: 68,492,492	D379G	probably damaging	Het
Pkdrej	A	T	15: 85,820,324	C470*	probably null	Het
Plxnd1	A	T	6: 115,969,441		probably null	Het
Polr1a	G	A	6: 71,966,524	V1248I	probably damaging	Het
Pou3f2	A	T	4: 22,486,917	C405*	probably null	Het
Ppp1r3a	A	T	6: 14,718,405	S837T	probably damaging	Het
Rest	T	A	5: 77,280,898	V388E	probably damaging	Het
Rnft2	A	T	5: 118,232,475	W220R	probably damaging	Het
Rnpc3	A	T	3: 113,621,910	Y107*	probably null	Het
Senp8	G	A	9: 59,737,552	S94F	probably damaging	Het
Ski	A	G	4: 155,222,241	S94P	possibly damaging	Het
Skint8	A	G	4: 111,936,995	D194G	probably damaging	Het
Slc35c2	C	A	2: 165,278,383	R232L	probably benign	Het
Slc43a3	T	A	2: 84,946,901	V198D	possibly damaging	Het
Slc8b1	A	T	5: 120,529,652	N467I	probably damaging	Het
Srbd1	A	G	17: 86,115,304		probably benign	Het
Sstr3	T	C	15: 78,539,968	H193R	probably damaging	Het
Sv2c	A	C	13: 95,976,775	S555R	probably benign	Het
Tagln3	A	G	16: 45,711,650	V173A	possibly damaging	Het
Tctn2	C	A	5: 124,619,080		noncoding transcript	Het
Tfap2a	G	T	13: 40,728,408	H167Q	probably damaging	Het
Tmem213	A	G	6: 38,109,552	T48A	possibly damaging	Het
Tmem30c	A	G	16: 57,269,989		probably benign	Het
Tmem37	A	G	1: 120,068,222	S42P	probably damaging	Het
Tnxb	C	T	17: 34,703,457	Q2415*	probably null	Het
Ttyh1	T	C	7: 4,119,731	L26P	probably damaging	Het
Ubn2	T	A	6: 38,440,490	D154E	possibly damaging	Het
Vdac3	A	T	8: 22,580,537	Y119*	probably null	Het
Vmn2r58	T	C	7: 41,837,258	I738V	possibly damaging	Het
Zfp704	A	G	3: 9,474,491		probably benign	Het
Znfx1	G	A	2: 167,038,809	R352W	probably damaging	Het

Other mutations in Clcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Clcn1	APN	6	42291703	missense	probably damaging	1.00
IGL01732:Clcn1	APN	6	42310672	splice site	probably benign
IGL02055:Clcn1	APN	6	42307555	missense	probably damaging	1.00
IGL02507:Clcn1	APN	6	42307073	splice site	probably benign
IGL02649:Clcn1	APN	6	42298829	missense	probably damaging	1.00
IGL02739:Clcn1	APN	6	42286780	splice site	probably null
IGL03148:Clcn1	APN	6	42299991	critical splice donor site	probably null
IGL03190:Clcn1	APN	6	42290103	missense	probably benign	0.02
IGL03327:Clcn1	APN	6	42311219	missense	probably benign	0.00
IGL03346:Clcn1	APN	6	42311219	missense	probably benign	0.00
Faint	UTSW	6	42307265	missense	probably damaging	1.00
jack_spratt	UTSW	6	42310581	missense	probably benign
Limitations	UTSW	6	42310063	missense	possibly damaging	0.79
maimed	UTSW	6	42298820	missense	probably damaging	1.00
R0167:Clcn1	UTSW	6	42286836	missense	probably damaging	1.00
R0323:Clcn1	UTSW	6	42310140	missense	probably damaging	0.99
R0491:Clcn1	UTSW	6	42310581	missense	probably benign
R0573:Clcn1	UTSW	6	42313045	splice site	probably null
R0615:Clcn1	UTSW	6	42305575	missense	probably damaging	1.00
R0944:Clcn1	UTSW	6	42313141	missense	probably benign	0.00
R1562:Clcn1	UTSW	6	42300235	missense	probably benign	0.29
R1566:Clcn1	UTSW	6	42291440	missense	possibly damaging	0.58
R1692:Clcn1	UTSW	6	42313098	missense	possibly damaging	0.67
R1728:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1729:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1772:Clcn1	UTSW	6	42294145	missense	probably damaging	1.00
R1784:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1793:Clcn1	UTSW	6	42298926	critical splice donor site	probably null
R1861:Clcn1	UTSW	6	42313991	missense	possibly damaging	0.63
R1864:Clcn1	UTSW	6	42305541	missense	probably damaging	1.00
R2356:Clcn1	UTSW	6	42291625	missense	probably damaging	1.00
R2403:Clcn1	UTSW	6	42313112	missense	probably damaging	0.99
R2987:Clcn1	UTSW	6	42298850	missense	probably damaging	1.00
R3082:Clcn1	UTSW	6	42290178	missense	probably damaging	0.98
R3500:Clcn1	UTSW	6	42292995	missense	probably damaging	0.99
R3747:Clcn1	UTSW	6	42299915	missense	probably damaging	1.00
R3748:Clcn1	UTSW	6	42299915	missense	probably damaging	1.00
R4041:Clcn1	UTSW	6	42309968	missense	probably damaging	1.00
R4749:Clcn1	UTSW	6	42290197	splice site	probably null
R4836:Clcn1	UTSW	6	42309964	missense	probably damaging	0.96
R5021:Clcn1	UTSW	6	42310988	nonsense	probably null
R5085:Clcn1	UTSW	6	42313880	missense	probably benign	0.41
R5528:Clcn1	UTSW	6	42300341	missense	probably benign	0.01
R5628:Clcn1	UTSW	6	42298889	missense	probably damaging	0.96
R5678:Clcn1	UTSW	6	42307265	missense	probably damaging	1.00
R5943:Clcn1	UTSW	6	42292966	missense	probably damaging	1.00
R6053:Clcn1	UTSW	6	42300274	nonsense	probably null
R6175:Clcn1	UTSW	6	42314162	missense	probably damaging	1.00
R6394:Clcn1	UTSW	6	42307590	missense	possibly damaging	0.84
R6394:Clcn1	UTSW	6	42313238	missense	possibly damaging	0.82
R7012:Clcn1	UTSW	6	42290608	missense	probably benign	0.01
R7020:Clcn1	UTSW	6	42298820	missense	probably damaging	1.00
R7048:Clcn1	UTSW	6	42307543	missense	probably damaging	1.00
R7212:Clcn1	UTSW	6	42291389	missense	possibly damaging	0.46
R7225:Clcn1	UTSW	6	42293462	missense	probably damaging	1.00
R7264:Clcn1	UTSW	6	42298838	missense	probably damaging	1.00
R7636:Clcn1	UTSW	6	42291334	nonsense	probably null
R7663:Clcn1	UTSW	6	42310063	missense	possibly damaging	0.79
R7807:Clcn1	UTSW	6	42310348	splice site	probably null
R7954:Clcn1	UTSW	6	42286691	unclassified	probably benign
R8026:Clcn1	UTSW	6	42307661	critical splice donor site	probably null
R8045:Clcn1	UTSW	6	42290694	missense	probably damaging	1.00
R8499:Clcn1	UTSW	6	42307199	missense	probably damaging	1.00
R8523:Clcn1	UTSW	6	42307589	nonsense	probably null
Z1088:Clcn1	UTSW	6	42300360	missense	probably benign	0.40
Z1088:Clcn1	UTSW	6	42307256	missense	probably damaging	1.00
Z1176:Clcn1	UTSW	6	42307567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCATACTGATAGCTACAATCTGGG -3'
(R):5'- GCAGAGCCAAAAGCCAGTTG -3'

Sequencing Primer
(F):5'- CCGGTGGGAAAACCTAGGATG -3'
(R):5'- GCCAAAAGCCAGTTGTTTGAAC -3'

Posted On

2014-06-30