Incidental Mutation 'R1865:Clcn1'
ID208614
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission 039888-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1865 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42305541 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 442 (D442E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031894
AA Change: D514E

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: D514E

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163235
SMART Domains Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163936
AA Change: D442E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: D442E

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik A G 1: 158,969,524 noncoding transcript Het
Aatk G A 11: 120,010,222 T1059M probably benign Het
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
Apobr A G 7: 126,585,968 D217G probably benign Het
Aqp9 A C 9: 71,112,376 N267K probably benign Het
Arap2 A G 5: 62,698,263 V610A probably damaging Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Atn1 T C 6: 124,745,296 probably benign Het
Bcl7a A T 5: 123,355,969 D68V probably damaging Het
Cbl A C 9: 44,164,165 C394W probably damaging Het
Ccdc18 T A 5: 108,193,802 D854E probably benign Het
Ccdc93 A T 1: 121,499,227 E580V probably damaging Het
Cd180 T A 13: 102,706,009 M521K probably benign Het
Cd300ld2 T G 11: 115,012,618 probably benign Het
Cdh10 T C 15: 18,899,604 F6L probably benign Het
Cep78 A G 19: 15,956,004 S737P probably damaging Het
Ces1f G T 8: 93,274,265 probably benign Het
Col20a1 T C 2: 181,015,813 L1250P possibly damaging Het
Crispld2 G A 8: 120,010,567 G19E probably benign Het
Ctbp2 C T 7: 132,990,554 A849T probably benign Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cul4a A G 8: 13,142,589 T617A possibly damaging Het
Cyp2c68 G T 19: 39,734,289 R272S probably benign Het
Cystm1 A G 18: 36,366,676 Y48C unknown Het
Dach1 T A 14: 97,840,209 R579S possibly damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Dnah10 A C 5: 124,832,526 probably null Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Eif4g1 A G 16: 20,678,648 T202A probably damaging Het
Ephb4 A T 5: 137,363,310 Q525L possibly damaging Het
F2 T C 2: 91,635,194 D82G probably benign Het
Fam184b G T 5: 45,531,889 N868K possibly damaging Het
Fbxo25 A G 8: 13,935,248 T314A probably damaging Het
Folh1 A G 7: 86,725,906 M624T possibly damaging Het
Gabra5 G A 7: 57,489,192 R71* probably null Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Hmcn1 A T 1: 150,603,812 C4634S probably damaging Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Igfbp4 G A 11: 99,041,686 G64R probably damaging Het
Itch G A 2: 155,168,746 V45I probably damaging Het
Itgb1 T A 8: 128,720,457 F484L probably benign Het
Itpr3 A G 17: 27,120,023 I2593V probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Mast4 A T 13: 102,794,117 V209D probably damaging Het
Matn3 T A 12: 8,952,041 D84E probably damaging Het
Mcm7 T A 5: 138,170,375 Q18L possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Megf11 A G 9: 64,680,299 T460A probably benign Het
Mlh1 A T 9: 111,257,024 probably benign Het
Mylk T A 16: 34,912,230 S627T probably benign Het
Nat2 A G 8: 67,501,552 M105V possibly damaging Het
Nav2 A G 7: 49,548,195 T2A possibly damaging Het
Ndst3 A T 3: 123,671,471 I284N probably damaging Het
Nfix A G 8: 84,772,275 V23A possibly damaging Het
Nr2f1 T C 13: 78,189,926 Y200C probably damaging Het
Olfr117 T C 17: 37,659,863 I157V possibly damaging Het
Olfr304 T C 7: 86,386,561 Y33C probably damaging Het
Olfr52 T G 2: 86,181,538 D191A probably damaging Het
Olfr524 G A 7: 140,202,372 R133C probably damaging Het
Olfr933 T C 9: 38,975,904 V76A probably benign Het
Pcdhb21 T C 18: 37,514,595 V259A possibly damaging Het
Phip A T 9: 82,945,792 V127E probably damaging Het
Pik3r5 A G 11: 68,492,492 D379G probably damaging Het
Pkdrej A T 15: 85,820,324 C470* probably null Het
Plxnd1 A T 6: 115,969,441 probably null Het
Polr1a G A 6: 71,966,524 V1248I probably damaging Het
Pou3f2 A T 4: 22,486,917 C405* probably null Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Rest T A 5: 77,280,898 V388E probably damaging Het
Rnft2 A T 5: 118,232,475 W220R probably damaging Het
Rnpc3 A T 3: 113,621,910 Y107* probably null Het
Senp8 G A 9: 59,737,552 S94F probably damaging Het
Ski A G 4: 155,222,241 S94P possibly damaging Het
Skint8 A G 4: 111,936,995 D194G probably damaging Het
Slc35c2 C A 2: 165,278,383 R232L probably benign Het
Slc43a3 T A 2: 84,946,901 V198D possibly damaging Het
Slc8b1 A T 5: 120,529,652 N467I probably damaging Het
Srbd1 A G 17: 86,115,304 probably benign Het
Sstr3 T C 15: 78,539,968 H193R probably damaging Het
Sv2c A C 13: 95,976,775 S555R probably benign Het
Tagln3 A G 16: 45,711,650 V173A possibly damaging Het
Tctn2 C A 5: 124,619,080 noncoding transcript Het
Tfap2a G T 13: 40,728,408 H167Q probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem30c A G 16: 57,269,989 probably benign Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Tnxb C T 17: 34,703,457 Q2415* probably null Het
Ttyh1 T C 7: 4,119,731 L26P probably damaging Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Vdac3 A T 8: 22,580,537 Y119* probably null Het
Vmn2r58 T C 7: 41,837,258 I738V possibly damaging Het
Zfp704 A G 3: 9,474,491 probably benign Het
Znfx1 G A 2: 167,038,809 R352W probably damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 unclassified probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
maimed UTSW 6 42298820 missense probably damaging 1.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42291389 missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42293462 missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42298838 missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42291334 nonsense probably null
R7663:Clcn1 UTSW 6 42310063 missense possibly damaging 0.79
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATACTGATAGCTACAATCTGGG -3'
(R):5'- GCAGAGCCAAAAGCCAGTTG -3'

Sequencing Primer
(F):5'- CCGGTGGGAAAACCTAGGATG -3'
(R):5'- GCCAAAAGCCAGTTGTTTGAAC -3'
Posted On2014-06-30