Mutagenetix > Incidental Mutation

Incidental Mutation 'R1865:Polr1a'

208615

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

039888-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1865 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 71966524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1248 (V1248I)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296]

AlphaFold

O35134

Predicted Effect

probably damaging
Transcript: ENSMUST00000055296
AA Change: V1248I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: V1248I

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181028

Predicted Effect

unknown
Transcript: ENSMUST00000205517
AA Change: V273I

Meta Mutation Damage Score

0.8097

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.3%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	A	G	1: 158,969,524		noncoding transcript	Het
Aatk	G	A	11: 120,010,222	T1059M	probably benign	Het
Adgrg2	G	A	X: 160,482,351	M532I	probably benign	Het
Agrn	GCTCT	GCTCTCT	4: 156,166,519		probably null	Het
Ahcyl2	G	A	6: 29,908,355	V575M	probably damaging	Het
Apobr	A	G	7: 126,585,968	D217G	probably benign	Het
Aqp9	A	C	9: 71,112,376	N267K	probably benign	Het
Arap2	A	G	5: 62,698,263	V610A	probably damaging	Het
Arhgap21	T	C	2: 20,861,204	E893G	probably damaging	Het
Atn1	T	C	6: 124,745,296		probably benign	Het
Bcl7a	A	T	5: 123,355,969	D68V	probably damaging	Het
Cbl	A	C	9: 44,164,165	C394W	probably damaging	Het
Ccdc18	T	A	5: 108,193,802	D854E	probably benign	Het
Ccdc93	A	T	1: 121,499,227	E580V	probably damaging	Het
Cd180	T	A	13: 102,706,009	M521K	probably benign	Het
Cd300ld2	T	G	11: 115,012,618		probably benign	Het
Cdh10	T	C	15: 18,899,604	F6L	probably benign	Het
Cep78	A	G	19: 15,956,004	S737P	probably damaging	Het
Ces1f	G	T	8: 93,274,265		probably benign	Het
Clcn1	T	A	6: 42,305,541	D442E	probably damaging	Het
Col20a1	T	C	2: 181,015,813	L1250P	possibly damaging	Het
Crispld2	G	A	8: 120,010,567	G19E	probably benign	Het
Ctbp2	C	T	7: 132,990,554	A849T	probably benign	Het
Cts6	A	G	13: 61,201,579	I105T	probably benign	Het
Cul4a	A	G	8: 13,142,589	T617A	possibly damaging	Het
Cyp2c68	G	T	19: 39,734,289	R272S	probably benign	Het
Cystm1	A	G	18: 36,366,676	Y48C	unknown	Het
Dach1	T	A	14: 97,840,209	R579S	possibly damaging	Het
Ddrgk1	A	T	2: 130,654,295	I270N	probably damaging	Het
Dhx32	A	T	7: 133,737,296	C197S	probably benign	Het
Dnah10	A	C	5: 124,832,526		probably null	Het
Ecm2	T	C	13: 49,530,145	V533A	probably benign	Het
Eif4g1	A	G	16: 20,678,648	T202A	probably damaging	Het
Ephb4	A	T	5: 137,363,310	Q525L	possibly damaging	Het
F2	T	C	2: 91,635,194	D82G	probably benign	Het
Fam184b	G	T	5: 45,531,889	N868K	possibly damaging	Het
Fbxo25	A	G	8: 13,935,248	T314A	probably damaging	Het
Folh1	A	G	7: 86,725,906	M624T	possibly damaging	Het
Gabra5	G	A	7: 57,489,192	R71*	probably null	Het
Gmpr	G	T	13: 45,542,625	V278F	probably damaging	Het
Hmcn1	A	T	1: 150,603,812	C4634S	probably damaging	Het
Hspa5	T	C	2: 34,774,541	F336L	probably damaging	Het
Igfbp4	G	A	11: 99,041,686	G64R	probably damaging	Het
Itch	G	A	2: 155,168,746	V45I	probably damaging	Het
Itgb1	T	A	8: 128,720,457	F484L	probably benign	Het
Itpr3	A	G	17: 27,120,023	I2593V	probably benign	Het
Kcnj8	T	A	6: 142,570,240	H47L	probably damaging	Het
Lcn2	T	C	2: 32,385,422	T194A	possibly damaging	Het
Mast4	A	T	13: 102,794,117	V209D	probably damaging	Het
Matn3	T	A	12: 8,952,041	D84E	probably damaging	Het
Mcm7	T	A	5: 138,170,375	Q18L	possibly damaging	Het
Mctp1	G	A	13: 76,385,148	C205Y	possibly damaging	Het
Megf11	A	G	9: 64,680,299	T460A	probably benign	Het
Mlh1	A	T	9: 111,257,024		probably benign	Het
Mylk	T	A	16: 34,912,230	S627T	probably benign	Het
Nat2	A	G	8: 67,501,552	M105V	possibly damaging	Het
Nav2	A	G	7: 49,548,195	T2A	possibly damaging	Het
Ndst3	A	T	3: 123,671,471	I284N	probably damaging	Het
Nfix	A	G	8: 84,772,275	V23A	possibly damaging	Het
Nr2f1	T	C	13: 78,189,926	Y200C	probably damaging	Het
Olfr117	T	C	17: 37,659,863	I157V	possibly damaging	Het
Olfr304	T	C	7: 86,386,561	Y33C	probably damaging	Het
Olfr52	T	G	2: 86,181,538	D191A	probably damaging	Het
Olfr524	G	A	7: 140,202,372	R133C	probably damaging	Het
Olfr933	T	C	9: 38,975,904	V76A	probably benign	Het
Pcdhb21	T	C	18: 37,514,595	V259A	possibly damaging	Het
Phip	A	T	9: 82,945,792	V127E	probably damaging	Het
Pik3r5	A	G	11: 68,492,492	D379G	probably damaging	Het
Pkdrej	A	T	15: 85,820,324	C470*	probably null	Het
Plxnd1	A	T	6: 115,969,441		probably null	Het
Pou3f2	A	T	4: 22,486,917	C405*	probably null	Het
Ppp1r3a	A	T	6: 14,718,405	S837T	probably damaging	Het
Rest	T	A	5: 77,280,898	V388E	probably damaging	Het
Rnft2	A	T	5: 118,232,475	W220R	probably damaging	Het
Rnpc3	A	T	3: 113,621,910	Y107*	probably null	Het
Senp8	G	A	9: 59,737,552	S94F	probably damaging	Het
Ski	A	G	4: 155,222,241	S94P	possibly damaging	Het
Skint8	A	G	4: 111,936,995	D194G	probably damaging	Het
Slc35c2	C	A	2: 165,278,383	R232L	probably benign	Het
Slc43a3	T	A	2: 84,946,901	V198D	possibly damaging	Het
Slc8b1	A	T	5: 120,529,652	N467I	probably damaging	Het
Srbd1	A	G	17: 86,115,304		probably benign	Het
Sstr3	T	C	15: 78,539,968	H193R	probably damaging	Het
Sv2c	A	C	13: 95,976,775	S555R	probably benign	Het
Tagln3	A	G	16: 45,711,650	V173A	possibly damaging	Het
Tctn2	C	A	5: 124,619,080		noncoding transcript	Het
Tfap2a	G	T	13: 40,728,408	H167Q	probably damaging	Het
Tmem213	A	G	6: 38,109,552	T48A	possibly damaging	Het
Tmem30c	A	G	16: 57,269,989		probably benign	Het
Tmem37	A	G	1: 120,068,222	S42P	probably damaging	Het
Tnxb	C	T	17: 34,703,457	Q2415*	probably null	Het
Ttyh1	T	C	7: 4,119,731	L26P	probably damaging	Het
Ubn2	T	A	6: 38,440,490	D154E	possibly damaging	Het
Vdac3	A	T	8: 22,580,537	Y119*	probably null	Het
Vmn2r58	T	C	7: 41,837,258	I738V	possibly damaging	Het
Zfp704	A	G	3: 9,474,491		probably benign	Het
Znfx1	G	A	2: 167,038,809	R352W	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGGATAGCCTAACACTTGCTCC -3'
(R):5'- CCTGATGATGTGGCAGAAGG -3'

Sequencing Primer
(F):5'- GATAGCCTAACACTTGCTCCTGATTC -3'
(R):5'- CTGATGATGTGGCAGAAGGATACAC -3'

Posted On

2014-06-30