Incidental Mutation 'R1865:Aatk'
ID208651
Institutional Source Beutler Lab
Gene Symbol Aatk
Ensembl Gene ENSMUSG00000025375
Gene Nameapoptosis-associated tyrosine kinase
SynonymsAATYK1
MMRRC Submission 039888-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R1865 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120007313-120047167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120010222 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1059 (T1059M)
Ref Sequence ENSEMBL: ENSMUSP00000099309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026436] [ENSMUST00000064307] [ENSMUST00000103019] [ENSMUST00000103020] [ENSMUST00000106233]
Predicted Effect probably benign
Transcript: ENSMUST00000026436
SMART Domains Protein: ENSMUSP00000026436
Gene: ENSMUSG00000025372

DomainStartEndE-ValueType
Pfam:IMD 17 237 6e-101 PFAM
PDB:4JS0|B 261 292 2e-13 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064307
AA Change: T1116M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000067181
Gene: ENSMUSG00000025375
AA Change: T1116M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 49 N/A INTRINSIC
Pfam:Pkinase_Tyr 135 405 3.9e-63 PFAM
Pfam:Pkinase 136 404 2.6e-33 PFAM
low complexity region 425 457 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 615 624 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
low complexity region 808 819 N/A INTRINSIC
low complexity region 913 927 N/A INTRINSIC
low complexity region 934 943 N/A INTRINSIC
low complexity region 985 1004 N/A INTRINSIC
low complexity region 1063 1082 N/A INTRINSIC
low complexity region 1085 1096 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
low complexity region 1179 1204 N/A INTRINSIC
low complexity region 1319 1333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083666
Predicted Effect probably benign
Transcript: ENSMUST00000103019
AA Change: T1059M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099308
Gene: ENSMUSG00000025375
AA Change: T1059M

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103020
AA Change: T1059M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099309
Gene: ENSMUSG00000025375
AA Change: T1059M

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106233
SMART Domains Protein: ENSMUSP00000101840
Gene: ENSMUSG00000025372

DomainStartEndE-ValueType
Pfam:IMD 17 237 1.6e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198674
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a tyrosine kinase domain at the N-terminus and a proline-rich domain at the C-terminus. This gene is induced during apoptosis, and expression of this gene may be a necessary pre-requisite for the induction of growth arrest and/or apoptosis of myeloid precursor cells. This gene has been shown to produce neuronal differentiation in a neuroblastoma cell line. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased brain size, longer axons and fewer neurites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik A G 1: 158,969,524 noncoding transcript Het
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
Apobr A G 7: 126,585,968 D217G probably benign Het
Aqp9 A C 9: 71,112,376 N267K probably benign Het
Arap2 A G 5: 62,698,263 V610A probably damaging Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Atn1 T C 6: 124,745,296 probably benign Het
Bcl7a A T 5: 123,355,969 D68V probably damaging Het
Cbl A C 9: 44,164,165 C394W probably damaging Het
Ccdc18 T A 5: 108,193,802 D854E probably benign Het
Ccdc93 A T 1: 121,499,227 E580V probably damaging Het
Cd180 T A 13: 102,706,009 M521K probably benign Het
Cd300ld2 T G 11: 115,012,618 probably benign Het
Cdh10 T C 15: 18,899,604 F6L probably benign Het
Cep78 A G 19: 15,956,004 S737P probably damaging Het
Ces1f G T 8: 93,274,265 probably benign Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Col20a1 T C 2: 181,015,813 L1250P possibly damaging Het
Crispld2 G A 8: 120,010,567 G19E probably benign Het
Ctbp2 C T 7: 132,990,554 A849T probably benign Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cul4a A G 8: 13,142,589 T617A possibly damaging Het
Cyp2c68 G T 19: 39,734,289 R272S probably benign Het
Cystm1 A G 18: 36,366,676 Y48C unknown Het
Dach1 T A 14: 97,840,209 R579S possibly damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Dnah10 A C 5: 124,832,526 probably null Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Eif4g1 A G 16: 20,678,648 T202A probably damaging Het
Ephb4 A T 5: 137,363,310 Q525L possibly damaging Het
F2 T C 2: 91,635,194 D82G probably benign Het
Fam184b G T 5: 45,531,889 N868K possibly damaging Het
Fbxo25 A G 8: 13,935,248 T314A probably damaging Het
Folh1 A G 7: 86,725,906 M624T possibly damaging Het
Gabra5 G A 7: 57,489,192 R71* probably null Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Hmcn1 A T 1: 150,603,812 C4634S probably damaging Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Igfbp4 G A 11: 99,041,686 G64R probably damaging Het
Itch G A 2: 155,168,746 V45I probably damaging Het
Itgb1 T A 8: 128,720,457 F484L probably benign Het
Itpr3 A G 17: 27,120,023 I2593V probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Mast4 A T 13: 102,794,117 V209D probably damaging Het
Matn3 T A 12: 8,952,041 D84E probably damaging Het
Mcm7 T A 5: 138,170,375 Q18L possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Megf11 A G 9: 64,680,299 T460A probably benign Het
Mlh1 A T 9: 111,257,024 probably benign Het
Mylk T A 16: 34,912,230 S627T probably benign Het
Nat2 A G 8: 67,501,552 M105V possibly damaging Het
Nav2 A G 7: 49,548,195 T2A possibly damaging Het
Ndst3 A T 3: 123,671,471 I284N probably damaging Het
Nfix A G 8: 84,772,275 V23A possibly damaging Het
Nr2f1 T C 13: 78,189,926 Y200C probably damaging Het
Olfr117 T C 17: 37,659,863 I157V possibly damaging Het
Olfr304 T C 7: 86,386,561 Y33C probably damaging Het
Olfr52 T G 2: 86,181,538 D191A probably damaging Het
Olfr524 G A 7: 140,202,372 R133C probably damaging Het
Olfr933 T C 9: 38,975,904 V76A probably benign Het
Pcdhb21 T C 18: 37,514,595 V259A possibly damaging Het
Phip A T 9: 82,945,792 V127E probably damaging Het
Pik3r5 A G 11: 68,492,492 D379G probably damaging Het
Pkdrej A T 15: 85,820,324 C470* probably null Het
Plxnd1 A T 6: 115,969,441 probably null Het
Polr1a G A 6: 71,966,524 V1248I probably damaging Het
Pou3f2 A T 4: 22,486,917 C405* probably null Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Rest T A 5: 77,280,898 V388E probably damaging Het
Rnft2 A T 5: 118,232,475 W220R probably damaging Het
Rnpc3 A T 3: 113,621,910 Y107* probably null Het
Senp8 G A 9: 59,737,552 S94F probably damaging Het
Ski A G 4: 155,222,241 S94P possibly damaging Het
Skint8 A G 4: 111,936,995 D194G probably damaging Het
Slc35c2 C A 2: 165,278,383 R232L probably benign Het
Slc43a3 T A 2: 84,946,901 V198D possibly damaging Het
Slc8b1 A T 5: 120,529,652 N467I probably damaging Het
Srbd1 A G 17: 86,115,304 probably benign Het
Sstr3 T C 15: 78,539,968 H193R probably damaging Het
Sv2c A C 13: 95,976,775 S555R probably benign Het
Tagln3 A G 16: 45,711,650 V173A possibly damaging Het
Tctn2 C A 5: 124,619,080 noncoding transcript Het
Tfap2a G T 13: 40,728,408 H167Q probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem30c A G 16: 57,269,989 probably benign Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Tnxb C T 17: 34,703,457 Q2415* probably null Het
Ttyh1 T C 7: 4,119,731 L26P probably damaging Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Vdac3 A T 8: 22,580,537 Y119* probably null Het
Vmn2r58 T C 7: 41,837,258 I738V possibly damaging Het
Zfp704 A G 3: 9,474,491 probably benign Het
Znfx1 G A 2: 167,038,809 R352W probably damaging Het
Other mutations in Aatk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Aatk APN 11 120010186 missense probably benign 0.02
IGL00953:Aatk APN 11 120011221 missense probably benign 0.00
IGL01019:Aatk APN 11 120012275 missense probably benign
IGL01758:Aatk APN 11 120010819 missense possibly damaging 0.86
IGL02377:Aatk APN 11 120046863 utr 5 prime probably benign
IGL02902:Aatk APN 11 120011777 missense probably benign 0.00
IGL03067:Aatk APN 11 120010083 missense probably benign 0.00
IGL03116:Aatk APN 11 120016751 missense probably benign 0.14
IGL03279:Aatk APN 11 120013678 missense probably damaging 1.00
IGL03405:Aatk APN 11 120016403 missense probably benign 0.02
PIT4366001:Aatk UTSW 11 120010960 missense possibly damaging 0.55
PIT4802001:Aatk UTSW 11 120011346 missense probably benign
R0101:Aatk UTSW 11 120010913 missense probably benign 0.19
R0497:Aatk UTSW 11 120018780 missense probably damaging 0.99
R0535:Aatk UTSW 11 120010193 missense probably benign 0.00
R0638:Aatk UTSW 11 120009922 missense probably damaging 1.00
R0939:Aatk UTSW 11 120012143 missense probably damaging 0.99
R1475:Aatk UTSW 11 120010888 missense probably damaging 0.96
R1840:Aatk UTSW 11 120013732 missense probably damaging 1.00
R1982:Aatk UTSW 11 120013514 missense probably damaging 1.00
R2027:Aatk UTSW 11 120009317 missense probably damaging 1.00
R2115:Aatk UTSW 11 120009736 missense probably benign
R2220:Aatk UTSW 11 120012177 missense probably damaging 1.00
R2264:Aatk UTSW 11 120010274 missense probably damaging 1.00
R2504:Aatk UTSW 11 120018855 missense probably benign 0.00
R3872:Aatk UTSW 11 120010219 missense possibly damaging 0.71
R4551:Aatk UTSW 11 120011569 missense probably benign 0.03
R4657:Aatk UTSW 11 120013478 missense possibly damaging 0.69
R4744:Aatk UTSW 11 120016122 missense possibly damaging 0.64
R4924:Aatk UTSW 11 120011525 missense probably damaging 1.00
R5063:Aatk UTSW 11 120010489 missense probably benign 0.07
R5223:Aatk UTSW 11 120013452 missense possibly damaging 0.95
R5243:Aatk UTSW 11 120016768 missense probably damaging 1.00
R5376:Aatk UTSW 11 120012034 missense probably damaging 0.98
R5442:Aatk UTSW 11 120018768 missense probably benign 0.02
R5550:Aatk UTSW 11 120009303 missense probably benign 0.42
R5678:Aatk UTSW 11 120010154 missense probably benign 0.00
R5932:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6026:Aatk UTSW 11 120012364 missense possibly damaging 0.65
R6129:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6409:Aatk UTSW 11 120011732 missense probably benign 0.01
R6477:Aatk UTSW 11 120018870 missense probably benign 0.00
R6478:Aatk UTSW 11 120010991 missense probably benign 0.00
R6749:Aatk UTSW 11 120010774 missense possibly damaging 0.58
R6753:Aatk UTSW 11 120010151 missense probably benign
R6787:Aatk UTSW 11 120010682 missense probably damaging 1.00
R6852:Aatk UTSW 11 120010468 missense probably benign 0.10
R7114:Aatk UTSW 11 120009619 missense probably benign
R7557:Aatk UTSW 11 120009430 missense possibly damaging 0.73
X0064:Aatk UTSW 11 120011176 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TAGATTTCGGGCACTCTGGC -3'
(R):5'- CTTTTCCCAGGTCTGCAGTG -3'

Sequencing Primer
(F):5'- TAGCACCGGAGCTCCTCATC -3'
(R):5'- TCTGCAGTGTCCAGCGAG -3'
Posted On2014-06-30