Incidental Mutation 'R1865:Sv2c'
ID208660
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Namesynaptic vesicle glycoprotein 2c
Synonyms4930527L09Rik
MMRRC Submission 039888-MU
Accession Numbers

Genbank: NM_029210; MGI: 1922459

Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1865 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95954594-96132577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 95976775 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 555 (S555R)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
Predicted Effect probably benign
Transcript: ENSMUST00000161263
AA Change: S555R

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: S555R

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182180
Predicted Effect probably benign
Transcript: ENSMUST00000182289
AA Change: S555R

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: S555R

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Meta Mutation Damage Score 0.2556 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (99/101)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik A G 1: 158,969,524 noncoding transcript Het
Aatk G A 11: 120,010,222 T1059M probably benign Het
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
Apobr A G 7: 126,585,968 D217G probably benign Het
Aqp9 A C 9: 71,112,376 N267K probably benign Het
Arap2 A G 5: 62,698,263 V610A probably damaging Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Atn1 T C 6: 124,745,296 probably benign Het
Bcl7a A T 5: 123,355,969 D68V probably damaging Het
Cbl A C 9: 44,164,165 C394W probably damaging Het
Ccdc18 T A 5: 108,193,802 D854E probably benign Het
Ccdc93 A T 1: 121,499,227 E580V probably damaging Het
Cd180 T A 13: 102,706,009 M521K probably benign Het
Cd300ld2 T G 11: 115,012,618 probably benign Het
Cdh10 T C 15: 18,899,604 F6L probably benign Het
Cep78 A G 19: 15,956,004 S737P probably damaging Het
Ces1f G T 8: 93,274,265 probably benign Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Col20a1 T C 2: 181,015,813 L1250P possibly damaging Het
Crispld2 G A 8: 120,010,567 G19E probably benign Het
Ctbp2 C T 7: 132,990,554 A849T probably benign Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cul4a A G 8: 13,142,589 T617A possibly damaging Het
Cyp2c68 G T 19: 39,734,289 R272S probably benign Het
Cystm1 A G 18: 36,366,676 Y48C unknown Het
Dach1 T A 14: 97,840,209 R579S possibly damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Dnah10 A C 5: 124,832,526 probably null Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Eif4g1 A G 16: 20,678,648 T202A probably damaging Het
Ephb4 A T 5: 137,363,310 Q525L possibly damaging Het
F2 T C 2: 91,635,194 D82G probably benign Het
Fam184b G T 5: 45,531,889 N868K possibly damaging Het
Fbxo25 A G 8: 13,935,248 T314A probably damaging Het
Folh1 A G 7: 86,725,906 M624T possibly damaging Het
Gabra5 G A 7: 57,489,192 R71* probably null Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Hmcn1 A T 1: 150,603,812 C4634S probably damaging Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Igfbp4 G A 11: 99,041,686 G64R probably damaging Het
Itch G A 2: 155,168,746 V45I probably damaging Het
Itgb1 T A 8: 128,720,457 F484L probably benign Het
Itpr3 A G 17: 27,120,023 I2593V probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Mast4 A T 13: 102,794,117 V209D probably damaging Het
Matn3 T A 12: 8,952,041 D84E probably damaging Het
Mcm7 T A 5: 138,170,375 Q18L possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Megf11 A G 9: 64,680,299 T460A probably benign Het
Mlh1 A T 9: 111,257,024 probably benign Het
Mylk T A 16: 34,912,230 S627T probably benign Het
Nat2 A G 8: 67,501,552 M105V possibly damaging Het
Nav2 A G 7: 49,548,195 T2A possibly damaging Het
Ndst3 A T 3: 123,671,471 I284N probably damaging Het
Nfix A G 8: 84,772,275 V23A possibly damaging Het
Nr2f1 T C 13: 78,189,926 Y200C probably damaging Het
Olfr117 T C 17: 37,659,863 I157V possibly damaging Het
Olfr304 T C 7: 86,386,561 Y33C probably damaging Het
Olfr52 T G 2: 86,181,538 D191A probably damaging Het
Olfr524 G A 7: 140,202,372 R133C probably damaging Het
Olfr933 T C 9: 38,975,904 V76A probably benign Het
Pcdhb21 T C 18: 37,514,595 V259A possibly damaging Het
Phip A T 9: 82,945,792 V127E probably damaging Het
Pik3r5 A G 11: 68,492,492 D379G probably damaging Het
Pkdrej A T 15: 85,820,324 C470* probably null Het
Plxnd1 A T 6: 115,969,441 probably null Het
Polr1a G A 6: 71,966,524 V1248I probably damaging Het
Pou3f2 A T 4: 22,486,917 C405* probably null Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Rest T A 5: 77,280,898 V388E probably damaging Het
Rnft2 A T 5: 118,232,475 W220R probably damaging Het
Rnpc3 A T 3: 113,621,910 Y107* probably null Het
Senp8 G A 9: 59,737,552 S94F probably damaging Het
Ski A G 4: 155,222,241 S94P possibly damaging Het
Skint8 A G 4: 111,936,995 D194G probably damaging Het
Slc35c2 C A 2: 165,278,383 R232L probably benign Het
Slc43a3 T A 2: 84,946,901 V198D possibly damaging Het
Slc8b1 A T 5: 120,529,652 N467I probably damaging Het
Srbd1 A G 17: 86,115,304 probably benign Het
Sstr3 T C 15: 78,539,968 H193R probably damaging Het
Tagln3 A G 16: 45,711,650 V173A possibly damaging Het
Tctn2 C A 5: 124,619,080 noncoding transcript Het
Tfap2a G T 13: 40,728,408 H167Q probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem30c A G 16: 57,269,989 probably benign Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Tnxb C T 17: 34,703,457 Q2415* probably null Het
Ttyh1 T C 7: 4,119,731 L26P probably damaging Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Vdac3 A T 8: 22,580,537 Y119* probably null Het
Vmn2r58 T C 7: 41,837,258 I738V possibly damaging Het
Zfp704 A G 3: 9,474,491 probably benign Het
Znfx1 G A 2: 167,038,809 R352W probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96048429 missense probably damaging 1.00
IGL01313:Sv2c APN 13 96088289 missense probably damaging 1.00
IGL02710:Sv2c APN 13 95989141 missense probably damaging 0.99
IGL02990:Sv2c APN 13 96088378 missense probably damaging 1.00
IGL03145:Sv2c APN 13 95989098 missense probably damaging 1.00
D4043:Sv2c UTSW 13 96088481 missense probably benign 0.27
R0390:Sv2c UTSW 13 96088708 missense probably benign
R0849:Sv2c UTSW 13 95989811 missense probably damaging 1.00
R0907:Sv2c UTSW 13 96088255 missense probably damaging 1.00
R1177:Sv2c UTSW 13 95989763 missense possibly damaging 0.79
R1840:Sv2c UTSW 13 95981844 missense probably benign 0.08
R1959:Sv2c UTSW 13 95976645 missense probably damaging 1.00
R2440:Sv2c UTSW 13 96048576 missense probably damaging 1.00
R4007:Sv2c UTSW 13 95986833 splice site probably benign
R4197:Sv2c UTSW 13 95978128 missense probably damaging 1.00
R4697:Sv2c UTSW 13 95986018 missense possibly damaging 0.64
R4719:Sv2c UTSW 13 95986811 missense probably benign 0.21
R4822:Sv2c UTSW 13 95985949 missense probably damaging 1.00
R5237:Sv2c UTSW 13 95981883 missense possibly damaging 0.76
R5452:Sv2c UTSW 13 95978083 missense probably damaging 1.00
R5531:Sv2c UTSW 13 95961378 missense probably damaging 0.98
R5756:Sv2c UTSW 13 95985967 missense probably benign
R5982:Sv2c UTSW 13 95976063 nonsense probably null
R6220:Sv2c UTSW 13 95976626 missense probably damaging 1.00
R6511:Sv2c UTSW 13 96048525 missense probably benign 0.00
R6520:Sv2c UTSW 13 95986721 missense probably benign
R7001:Sv2c UTSW 13 95981953 missense probably benign 0.11
R7073:Sv2c UTSW 13 96088250 missense probably damaging 1.00
R7116:Sv2c UTSW 13 95976644 missense probably damaging 1.00
R7261:Sv2c UTSW 13 96088301 missense probably damaging 1.00
R7374:Sv2c UTSW 13 95989136 missense probably damaging 1.00
R7423:Sv2c UTSW 13 96048548 missense probably benign 0.03
R7626:Sv2c UTSW 13 95985943 missense probably benign 0.13
R7727:Sv2c UTSW 13 95976695 missense possibly damaging 0.89
R7767:Sv2c UTSW 13 95989715 missense probably damaging 1.00
R7818:Sv2c UTSW 13 95986820 nonsense probably null
R7831:Sv2c UTSW 13 95976692 missense probably damaging 1.00
R7914:Sv2c UTSW 13 95976692 missense probably damaging 1.00
Z1176:Sv2c UTSW 13 95976097 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTAAACGCCCGATCCTGTC -3'
(R):5'- GCTGCTTGGTAAGGTGACAC -3'

Sequencing Primer
(F):5'- CTGTCCATCAGGAGAGCAGAC -3'
(R):5'- GCTCTCATGTTCTAGCAAGTCAAAC -3'
Posted On2014-06-30