Incidental Mutation 'R1865:Mast4'
ID208662
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission 039888-MU
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R1865 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102794117 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 209 (V209D)
Ref Sequence ENSEMBL: ENSMUSP00000131651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166336] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]
Predicted Effect probably damaging
Transcript: ENSMUST00000099202
AA Change: V224D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: V224D

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166336
SMART Domains Protein: ENSMUSP00000126516
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 71 212 1.2e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166726
AA Change: V401D

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: V401D

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167058
AA Change: V401D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: V401D

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167462
AA Change: V209D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751
AA Change: V209D

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171791
AA Change: V209D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: V209D

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172264
AA Change: V197D

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751
AA Change: V197D

DomainStartEndE-ValueType
Pfam:DUF1908 49 326 4.1e-147 PFAM
S_TKc 364 637 4.13e-98 SMART
S_TK_X 638 702 3.79e-2 SMART
low complexity region 718 731 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 813 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185947
Predicted Effect unknown
Transcript: ENSMUST00000194446
AA Change: V233D
Meta Mutation Damage Score 0.2896 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik A G 1: 158,969,524 noncoding transcript Het
Aatk G A 11: 120,010,222 T1059M probably benign Het
Adgrg2 G A X: 160,482,351 M532I probably benign Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Ahcyl2 G A 6: 29,908,355 V575M probably damaging Het
Apobr A G 7: 126,585,968 D217G probably benign Het
Aqp9 A C 9: 71,112,376 N267K probably benign Het
Arap2 A G 5: 62,698,263 V610A probably damaging Het
Arhgap21 T C 2: 20,861,204 E893G probably damaging Het
Atn1 T C 6: 124,745,296 probably benign Het
Bcl7a A T 5: 123,355,969 D68V probably damaging Het
Cbl A C 9: 44,164,165 C394W probably damaging Het
Ccdc18 T A 5: 108,193,802 D854E probably benign Het
Ccdc93 A T 1: 121,499,227 E580V probably damaging Het
Cd180 T A 13: 102,706,009 M521K probably benign Het
Cd300ld2 T G 11: 115,012,618 probably benign Het
Cdh10 T C 15: 18,899,604 F6L probably benign Het
Cep78 A G 19: 15,956,004 S737P probably damaging Het
Ces1f G T 8: 93,274,265 probably benign Het
Clcn1 T A 6: 42,305,541 D442E probably damaging Het
Col20a1 T C 2: 181,015,813 L1250P possibly damaging Het
Crispld2 G A 8: 120,010,567 G19E probably benign Het
Ctbp2 C T 7: 132,990,554 A849T probably benign Het
Cts6 A G 13: 61,201,579 I105T probably benign Het
Cul4a A G 8: 13,142,589 T617A possibly damaging Het
Cyp2c68 G T 19: 39,734,289 R272S probably benign Het
Cystm1 A G 18: 36,366,676 Y48C unknown Het
Dach1 T A 14: 97,840,209 R579S possibly damaging Het
Ddrgk1 A T 2: 130,654,295 I270N probably damaging Het
Dhx32 A T 7: 133,737,296 C197S probably benign Het
Dnah10 A C 5: 124,832,526 probably null Het
Ecm2 T C 13: 49,530,145 V533A probably benign Het
Eif4g1 A G 16: 20,678,648 T202A probably damaging Het
Ephb4 A T 5: 137,363,310 Q525L possibly damaging Het
F2 T C 2: 91,635,194 D82G probably benign Het
Fam184b G T 5: 45,531,889 N868K possibly damaging Het
Fbxo25 A G 8: 13,935,248 T314A probably damaging Het
Folh1 A G 7: 86,725,906 M624T possibly damaging Het
Gabra5 G A 7: 57,489,192 R71* probably null Het
Gmpr G T 13: 45,542,625 V278F probably damaging Het
Hmcn1 A T 1: 150,603,812 C4634S probably damaging Het
Hspa5 T C 2: 34,774,541 F336L probably damaging Het
Igfbp4 G A 11: 99,041,686 G64R probably damaging Het
Itch G A 2: 155,168,746 V45I probably damaging Het
Itgb1 T A 8: 128,720,457 F484L probably benign Het
Itpr3 A G 17: 27,120,023 I2593V probably benign Het
Kcnj8 T A 6: 142,570,240 H47L probably damaging Het
Lcn2 T C 2: 32,385,422 T194A possibly damaging Het
Matn3 T A 12: 8,952,041 D84E probably damaging Het
Mcm7 T A 5: 138,170,375 Q18L possibly damaging Het
Mctp1 G A 13: 76,385,148 C205Y possibly damaging Het
Megf11 A G 9: 64,680,299 T460A probably benign Het
Mlh1 A T 9: 111,257,024 probably benign Het
Mylk T A 16: 34,912,230 S627T probably benign Het
Nat2 A G 8: 67,501,552 M105V possibly damaging Het
Nav2 A G 7: 49,548,195 T2A possibly damaging Het
Ndst3 A T 3: 123,671,471 I284N probably damaging Het
Nfix A G 8: 84,772,275 V23A possibly damaging Het
Nr2f1 T C 13: 78,189,926 Y200C probably damaging Het
Olfr117 T C 17: 37,659,863 I157V possibly damaging Het
Olfr304 T C 7: 86,386,561 Y33C probably damaging Het
Olfr52 T G 2: 86,181,538 D191A probably damaging Het
Olfr524 G A 7: 140,202,372 R133C probably damaging Het
Olfr933 T C 9: 38,975,904 V76A probably benign Het
Pcdhb21 T C 18: 37,514,595 V259A possibly damaging Het
Phip A T 9: 82,945,792 V127E probably damaging Het
Pik3r5 A G 11: 68,492,492 D379G probably damaging Het
Pkdrej A T 15: 85,820,324 C470* probably null Het
Plxnd1 A T 6: 115,969,441 probably null Het
Polr1a G A 6: 71,966,524 V1248I probably damaging Het
Pou3f2 A T 4: 22,486,917 C405* probably null Het
Ppp1r3a A T 6: 14,718,405 S837T probably damaging Het
Rest T A 5: 77,280,898 V388E probably damaging Het
Rnft2 A T 5: 118,232,475 W220R probably damaging Het
Rnpc3 A T 3: 113,621,910 Y107* probably null Het
Senp8 G A 9: 59,737,552 S94F probably damaging Het
Ski A G 4: 155,222,241 S94P possibly damaging Het
Skint8 A G 4: 111,936,995 D194G probably damaging Het
Slc35c2 C A 2: 165,278,383 R232L probably benign Het
Slc43a3 T A 2: 84,946,901 V198D possibly damaging Het
Slc8b1 A T 5: 120,529,652 N467I probably damaging Het
Srbd1 A G 17: 86,115,304 probably benign Het
Sstr3 T C 15: 78,539,968 H193R probably damaging Het
Sv2c A C 13: 95,976,775 S555R probably benign Het
Tagln3 A G 16: 45,711,650 V173A possibly damaging Het
Tctn2 C A 5: 124,619,080 noncoding transcript Het
Tfap2a G T 13: 40,728,408 H167Q probably damaging Het
Tmem213 A G 6: 38,109,552 T48A possibly damaging Het
Tmem30c A G 16: 57,269,989 probably benign Het
Tmem37 A G 1: 120,068,222 S42P probably damaging Het
Tnxb C T 17: 34,703,457 Q2415* probably null Het
Ttyh1 T C 7: 4,119,731 L26P probably damaging Het
Ubn2 T A 6: 38,440,490 D154E possibly damaging Het
Vdac3 A T 8: 22,580,537 Y119* probably null Het
Vmn2r58 T C 7: 41,837,258 I738V possibly damaging Het
Zfp704 A G 3: 9,474,491 probably benign Het
Znfx1 G A 2: 167,038,809 R352W probably damaging Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
skinnybones UTSW 13 102804641 critical splice donor site probably null
BB010:Mast4 UTSW 13 102772563 missense probably damaging 0.99
BB020:Mast4 UTSW 13 102772563 missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102804641 critical splice donor site probably null
R7514:Mast4 UTSW 13 102787426 nonsense probably null
R7697:Mast4 UTSW 13 102739203 missense probably damaging 1.00
R7820:Mast4 UTSW 13 102754088 missense probably damaging 1.00
R7874:Mast4 UTSW 13 102739275 missense probably damaging 1.00
R7933:Mast4 UTSW 13 102772563 missense probably damaging 0.99
R8042:Mast4 UTSW 13 102781245 missense probably damaging 0.96
R8060:Mast4 UTSW 13 102737676 missense possibly damaging 0.89
R8172:Mast4 UTSW 13 102953125 critical splice donor site probably null
R8206:Mast4 UTSW 13 102735739 missense probably damaging 1.00
R8248:Mast4 UTSW 13 102738721 missense probably damaging 1.00
R8283:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R8346:Mast4 UTSW 13 102751478 missense probably damaging 0.99
R8434:Mast4 UTSW 13 102761392 missense probably damaging 1.00
RF005:Mast4 UTSW 13 102736307 small insertion probably benign
RF015:Mast4 UTSW 13 102739247 frame shift probably null
RF019:Mast4 UTSW 13 102736307 small insertion probably benign
RF037:Mast4 UTSW 13 102739241 small deletion probably benign
RF039:Mast4 UTSW 13 102739241 small deletion probably benign
RF040:Mast4 UTSW 13 102739241 small deletion probably benign
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102738460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAAGCCTTGTTCCTACC -3'
(R):5'- CAGTGGCCTATACTTCCAGC -3'

Sequencing Primer
(F):5'- CTCCTGGAGCAACTTGTCCAG -3'
(R):5'- AAATGCAACTCTCGGGATTCTC -3'
Posted On2014-06-30