Mutagenetix > Incidental Mutation

Incidental Mutation 'R1866:Trip12'

208684

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

039889-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1866 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84745060 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 128 (D128G)

Ref Sequence

ENSEMBL: ENSMUSP00000140789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000189670] [ENSMUST00000189841]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: D1323G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: D1323G

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185909

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: D1323G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: D1323G

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: D1290G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: D1290G

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189670
AA Change: D128G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219
AA Change: D128G

Domain	Start	End	E-Value	Type
low complexity region	138	149	N/A	INTRINSIC
low complexity region	150	167	N/A	INTRINSIC
Blast:HECTc	168	222	5e-8	BLAST
Blast:HECTc	378	434	1e-24	BLAST
HECTc	441	830	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189841

SMART Domains

Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	1	24	N/A	INTRINSIC
low complexity region	51	63	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190125

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apba1	A	T	19: 23,892,831	E9V	probably benign	Het
Armc8	T	A	9: 99,536,280	T32S	probably benign	Het
Atr	T	A	9: 95,870,605		probably null	Het
Blm	A	G	7: 80,494,114	L859P	probably benign	Het
Cacna2d3	A	T	14: 28,969,214	F51L	probably damaging	Het
Cdcp2	A	G	4: 107,107,000	N349S	probably damaging	Het
Cfap57	G	A	4: 118,599,927	H442Y	possibly damaging	Het
Chrm3	A	G	13: 9,878,481	L173P	probably damaging	Het
Cpb1	C	G	3: 20,263,756	M201I	probably benign	Het
Dgcr8	A	T	16: 18,258,314	N2K	probably damaging	Het
Dnah3	A	T	7: 119,928,856		probably null	Het
Dnah6	T	A	6: 73,100,088	Q2398L	probably benign	Het
Dpep2	A	T	8: 105,989,448		probably null	Het
E430018J23Rik	A	G	7: 127,393,331	W36R	probably damaging	Het
Eif2ak4	C	A	2: 118,472,661	T1504K	probably damaging	Het
Exoc6b	A	G	6: 84,851,914	V496A	probably damaging	Het
Fam174a	A	C	1: 95,313,895	S27R	probably benign	Het
Fat2	T	A	11: 55,292,014	Q1339L	probably benign	Het
Fkbpl	T	A	17: 34,645,823	D188E	possibly damaging	Het
Focad	A	G	4: 88,407,165	D89G	possibly damaging	Het
Fstl4	C	A	11: 53,186,398	Q661K	probably benign	Het
Gck	T	C	11: 5,903,253	Y289C	probably benign	Het
Gm156	A	G	6: 129,775,380		probably null	Het
Gm16181	T	A	17: 35,223,937		probably benign	Het
Herc1	G	A	9: 66,450,791	G2385S	probably damaging	Het
Igfn1	T	C	1: 135,974,868		probably null	Het
Il12b	T	C	11: 44,408,526	W141R	probably damaging	Het
Itga6	T	A	2: 71,834,070	S517T	probably benign	Het
Kank1	A	G	19: 25,411,449	S801G	probably benign	Het
Lctl	A	G	9: 64,131,721	D205G	probably damaging	Het
Lhx3	A	C	2: 26,203,974	V79G	probably damaging	Het
Lrrc9	T	C	12: 72,497,138	I1127T	probably damaging	Het
Ltbp3	A	T	19: 5,747,849	E505D	probably benign	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map6	A	G	7: 99,315,876	S291G	probably damaging	Het
Mapk7	A	G	11: 61,489,413	F671L	probably benign	Het
Mau2	A	G	8: 70,031,492	W149R	probably damaging	Het
Mb21d2	C	T	16: 28,828,515	V236I	possibly damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Mical1	C	A	10: 41,485,470	P797Q	probably benign	Het
Mnx1	G	A	5: 29,474,045	R347C	unknown	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Nlrp2	G	T	7: 5,327,716	C560*	probably null	Het
Npat	T	A	9: 53,563,116	L736H	probably damaging	Het
Nup155	T	A	15: 8,115,526	V147E	probably damaging	Het
Nxpe2	A	G	9: 48,326,821	F45L	probably benign	Het
Obscn	T	C	11: 59,060,915	D4370G	probably benign	Het
Olfr1000	T	A	2: 85,608,844	H22L	probably benign	Het
Olfr1047	A	C	2: 86,228,728	M81R	probably damaging	Het
Olfr1252	T	C	2: 89,721,206	K302E	probably benign	Het
Olfr1260	T	C	2: 89,978,327	L183S	probably damaging	Het
Olfr1425	A	G	19: 12,073,819	V271A	probably benign	Het
Olfr1532-ps1	A	G	7: 106,915,066	I289M	probably damaging	Het
Olfr658	A	G	7: 104,644,797	S190P	probably benign	Het
Pcx	T	C	19: 4,621,221	I1157T	possibly damaging	Het
Pias2	T	A	18: 77,152,716	S589R	probably benign	Het
Plcb1	T	C	2: 135,344,173	F687L	probably benign	Het
Plk5	G	T	10: 80,360,569		probably null	Het
Pnpla2	T	A	7: 141,455,416	Y44N	probably damaging	Het
Ppp1r12a	T	A	10: 108,262,431	D337E	possibly damaging	Het
Prl2c5	G	T	13: 13,190,773		probably null	Het
Prom2	T	C	2: 127,536,594	D460G	probably damaging	Het
Pros1	A	G	16: 62,928,135	H657R	possibly damaging	Het
Prune2	A	G	19: 17,123,492	E2120G	probably damaging	Het
Rap2a	T	A	14: 120,478,935	L70Q	probably damaging	Het
Rbl2	A	T	8: 91,112,529	E858D	probably benign	Het
Rbm48	T	C	5: 3,595,997	Y69C	probably damaging	Het
Rgs12	T	A	5: 34,965,674	I267N	probably damaging	Het
Rpusd2	G	T	2: 119,035,247	A142S	probably benign	Het
Rspo2	A	T	15: 43,075,936	W153R	probably damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Serinc5	T	A	13: 92,706,263	M407K	probably damaging	Het
Slain2	T	C	5: 72,957,322	S299P	probably damaging	Het
Slc17a4	A	G	13: 23,900,545	Y419H	possibly damaging	Het
Slc1a6	T	A	10: 78,791,349	D173E	probably damaging	Het
Slc22a19	A	T	19: 7,711,141	I18N	probably damaging	Het
Slc37a3	A	T	6: 39,359,968	F91L	probably damaging	Het
Spag5	C	A	11: 78,304,455	T196K	possibly damaging	Het
Susd2	G	T	10: 75,639,732	A326D	probably damaging	Het
Syna	G	T	5: 134,559,915	A60D	probably damaging	Het
Tchh	A	T	3: 93,447,760	E1502D	unknown	Het
Tecta	T	C	9: 42,392,024	H104R	probably damaging	Het
Tmed1	T	C	9: 21,509,091	D102G	probably damaging	Het
Uroc1	A	G	6: 90,361,524	M656V	probably benign	Het
Usp47	T	A	7: 112,101,870	V1096D	possibly damaging	Het
Utp20	T	A	10: 88,762,770	K115*	probably null	Het
Vmn2r19	G	T	6: 123,331,638		probably null	Het
Vmn2r86	A	T	10: 130,446,386	V787D	probably damaging	Het
Vmn2r87	A	T	10: 130,472,572	I599N	possibly damaging	Het
Vwf	A	G	6: 125,667,529	D2449G	possibly damaging	Het
Zbtb7c	T	A	18: 76,136,906	C22S	probably benign	Het
Zc3h7a	A	G	16: 11,147,304	I655T	possibly damaging	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTATTAAGCAAGTTCAACATATGCC -3'
(R):5'- AGTGGCTAGAGATCATGTTCATTTC -3'

Sequencing Primer
(F):5'- CTATTTCTAATAGGACCAGAGGTTCC -3'
(R):5'- GCTTTTCATATGCAGAAAAACCGAC -3'

Posted On

2014-06-30