Incidental Mutation 'R1866:Slc37a3'
ID208714
Institutional Source Beutler Lab
Gene Symbol Slc37a3
Ensembl Gene ENSMUSG00000029924
Gene Namesolute carrier family 37 (glycerol-3-phosphate transporter), member 3
Synonyms
MMRRC Submission 039889-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1866 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39334773-39377675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39359968 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 91 (F91L)
Ref Sequence ENSEMBL: ENSMUSP00000144316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090243] [ENSMUST00000200771] [ENSMUST00000200961] [ENSMUST00000200969] [ENSMUST00000201448] [ENSMUST00000202204] [ENSMUST00000202400] [ENSMUST00000202749]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090243
AA Change: F91L

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087709
Gene: ENSMUSG00000029924
AA Change: F91L

DomainStartEndE-ValueType
Pfam:MFS_1 23 420 3.8e-37 PFAM
Pfam:Sugar_tr 27 262 2.5e-8 PFAM
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200771
SMART Domains Protein: ENSMUSP00000143953
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200961
AA Change: F91L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144562
Gene: ENSMUSG00000029924
AA Change: F91L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200969
SMART Domains Protein: ENSMUSP00000144244
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201448
AA Change: F91L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144059
Gene: ENSMUSG00000029924
AA Change: F91L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202204
AA Change: F91L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144316
Gene: ENSMUSG00000029924
AA Change: F91L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202400
AA Change: F91L

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144557
Gene: ENSMUSG00000029924
AA Change: F91L

DomainStartEndE-ValueType
Pfam:MFS_1 12 173 2.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000202749
AA Change: F70Y
SMART Domains Protein: ENSMUSP00000144636
Gene: ENSMUSG00000029924
AA Change: F70Y

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 A T 19: 23,892,831 E9V probably benign Het
Armc8 T A 9: 99,536,280 T32S probably benign Het
Atr T A 9: 95,870,605 probably null Het
Blm A G 7: 80,494,114 L859P probably benign Het
Cacna2d3 A T 14: 28,969,214 F51L probably damaging Het
Cdcp2 A G 4: 107,107,000 N349S probably damaging Het
Cfap57 G A 4: 118,599,927 H442Y possibly damaging Het
Chrm3 A G 13: 9,878,481 L173P probably damaging Het
Cpb1 C G 3: 20,263,756 M201I probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Dnah3 A T 7: 119,928,856 probably null Het
Dnah6 T A 6: 73,100,088 Q2398L probably benign Het
Dpep2 A T 8: 105,989,448 probably null Het
E430018J23Rik A G 7: 127,393,331 W36R probably damaging Het
Eif2ak4 C A 2: 118,472,661 T1504K probably damaging Het
Exoc6b A G 6: 84,851,914 V496A probably damaging Het
Fam174a A C 1: 95,313,895 S27R probably benign Het
Fat2 T A 11: 55,292,014 Q1339L probably benign Het
Fkbpl T A 17: 34,645,823 D188E possibly damaging Het
Focad A G 4: 88,407,165 D89G possibly damaging Het
Fstl4 C A 11: 53,186,398 Q661K probably benign Het
Gck T C 11: 5,903,253 Y289C probably benign Het
Gm156 A G 6: 129,775,380 probably null Het
Gm16181 T A 17: 35,223,937 probably benign Het
Herc1 G A 9: 66,450,791 G2385S probably damaging Het
Igfn1 T C 1: 135,974,868 probably null Het
Il12b T C 11: 44,408,526 W141R probably damaging Het
Itga6 T A 2: 71,834,070 S517T probably benign Het
Kank1 A G 19: 25,411,449 S801G probably benign Het
Lctl A G 9: 64,131,721 D205G probably damaging Het
Lhx3 A C 2: 26,203,974 V79G probably damaging Het
Lrrc9 T C 12: 72,497,138 I1127T probably damaging Het
Ltbp3 A T 19: 5,747,849 E505D probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map6 A G 7: 99,315,876 S291G probably damaging Het
Mapk7 A G 11: 61,489,413 F671L probably benign Het
Mau2 A G 8: 70,031,492 W149R probably damaging Het
Mb21d2 C T 16: 28,828,515 V236I possibly damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Mical1 C A 10: 41,485,470 P797Q probably benign Het
Mnx1 G A 5: 29,474,045 R347C unknown Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nlrp2 G T 7: 5,327,716 C560* probably null Het
Npat T A 9: 53,563,116 L736H probably damaging Het
Nup155 T A 15: 8,115,526 V147E probably damaging Het
Nxpe2 A G 9: 48,326,821 F45L probably benign Het
Obscn T C 11: 59,060,915 D4370G probably benign Het
Olfr1000 T A 2: 85,608,844 H22L probably benign Het
Olfr1047 A C 2: 86,228,728 M81R probably damaging Het
Olfr1252 T C 2: 89,721,206 K302E probably benign Het
Olfr1260 T C 2: 89,978,327 L183S probably damaging Het
Olfr1425 A G 19: 12,073,819 V271A probably benign Het
Olfr1532-ps1 A G 7: 106,915,066 I289M probably damaging Het
Olfr658 A G 7: 104,644,797 S190P probably benign Het
Pcx T C 19: 4,621,221 I1157T possibly damaging Het
Pias2 T A 18: 77,152,716 S589R probably benign Het
Plcb1 T C 2: 135,344,173 F687L probably benign Het
Plk5 G T 10: 80,360,569 probably null Het
Pnpla2 T A 7: 141,455,416 Y44N probably damaging Het
Ppp1r12a T A 10: 108,262,431 D337E possibly damaging Het
Prl2c5 G T 13: 13,190,773 probably null Het
Prom2 T C 2: 127,536,594 D460G probably damaging Het
Pros1 A G 16: 62,928,135 H657R possibly damaging Het
Prune2 A G 19: 17,123,492 E2120G probably damaging Het
Rap2a T A 14: 120,478,935 L70Q probably damaging Het
Rbl2 A T 8: 91,112,529 E858D probably benign Het
Rbm48 T C 5: 3,595,997 Y69C probably damaging Het
Rgs12 T A 5: 34,965,674 I267N probably damaging Het
Rpusd2 G T 2: 119,035,247 A142S probably benign Het
Rspo2 A T 15: 43,075,936 W153R probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Serinc5 T A 13: 92,706,263 M407K probably damaging Het
Slain2 T C 5: 72,957,322 S299P probably damaging Het
Slc17a4 A G 13: 23,900,545 Y419H possibly damaging Het
Slc1a6 T A 10: 78,791,349 D173E probably damaging Het
Slc22a19 A T 19: 7,711,141 I18N probably damaging Het
Spag5 C A 11: 78,304,455 T196K possibly damaging Het
Susd2 G T 10: 75,639,732 A326D probably damaging Het
Syna G T 5: 134,559,915 A60D probably damaging Het
Tchh A T 3: 93,447,760 E1502D unknown Het
Tecta T C 9: 42,392,024 H104R probably damaging Het
Tmed1 T C 9: 21,509,091 D102G probably damaging Het
Trip12 T C 1: 84,745,060 D128G probably damaging Het
Uroc1 A G 6: 90,361,524 M656V probably benign Het
Usp47 T A 7: 112,101,870 V1096D possibly damaging Het
Utp20 T A 10: 88,762,770 K115* probably null Het
Vmn2r19 G T 6: 123,331,638 probably null Het
Vmn2r86 A T 10: 130,446,386 V787D probably damaging Het
Vmn2r87 A T 10: 130,472,572 I599N possibly damaging Het
Vwf A G 6: 125,667,529 D2449G possibly damaging Het
Zbtb7c T A 18: 76,136,906 C22S probably benign Het
Zc3h7a A G 16: 11,147,304 I655T possibly damaging Het
Other mutations in Slc37a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Slc37a3 APN 6 39337262 missense probably damaging 1.00
IGL02447:Slc37a3 APN 6 39337195 missense probably benign 0.00
IGL03017:Slc37a3 APN 6 39349381 missense probably benign 0.13
IGL03142:Slc37a3 APN 6 39359985 splice site probably null
IGL03164:Slc37a3 APN 6 39345303 missense probably benign 0.02
R0240:Slc37a3 UTSW 6 39337238 missense probably benign 0.02
R0551:Slc37a3 UTSW 6 39352754 unclassified probably benign
R1453:Slc37a3 UTSW 6 39366943 missense probably damaging 1.00
R2242:Slc37a3 UTSW 6 39338805 missense probably benign 0.00
R4410:Slc37a3 UTSW 6 39338813 missense probably benign
R4784:Slc37a3 UTSW 6 39337223 missense probably benign 0.12
R4983:Slc37a3 UTSW 6 39352717 nonsense probably null
R5543:Slc37a3 UTSW 6 39355026 missense probably damaging 1.00
R6309:Slc37a3 UTSW 6 39357460 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGACAGCTACAGTGTACTCACATAC -3'
(R):5'- TTACCAGAGCTCACTGCCTTG -3'

Sequencing Primer
(F):5'- cagtgtactcacatacataaaataaa -3'
(R):5'- ACACCGGGGTCAGGCAATC -3'
Posted On2014-06-30