Incidental Mutation 'R1866:Vmn2r19'
ID 208718
Institutional Source Beutler Lab
Gene Symbol Vmn2r19
Ensembl Gene ENSMUSG00000091260
Gene Name vomeronasal 2, receptor 19
Synonyms EG232358
MMRRC Submission 039889-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R1866 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 123285292-123313496 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 123308597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073948]
AlphaFold G5E8G4
Predicted Effect probably null
Transcript: ENSMUST00000073948
SMART Domains Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 476 2.9e-35 PFAM
Pfam:NCD3G 518 571 8.3e-23 PFAM
Pfam:7tm_3 603 839 7.2e-52 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 A T 19: 23,870,195 (GRCm39) E9V probably benign Het
Armc8 T A 9: 99,418,333 (GRCm39) T32S probably benign Het
Atr T A 9: 95,752,658 (GRCm39) probably null Het
Blm A G 7: 80,143,862 (GRCm39) L859P probably benign Het
Cacna2d3 A T 14: 28,691,171 (GRCm39) F51L probably damaging Het
Cdcp2 A G 4: 106,964,197 (GRCm39) N349S probably damaging Het
Cfap57 G A 4: 118,457,124 (GRCm39) H442Y possibly damaging Het
Chrm3 A G 13: 9,928,517 (GRCm39) L173P probably damaging Het
Cpb1 C G 3: 20,317,920 (GRCm39) M201I probably benign Het
Dgcr8 A T 16: 18,076,178 (GRCm39) N2K probably damaging Het
Dnah3 A T 7: 119,528,079 (GRCm39) probably null Het
Dnah6 T A 6: 73,077,071 (GRCm39) Q2398L probably benign Het
Dpep2 A T 8: 106,716,080 (GRCm39) probably null Het
Eif2ak4 C A 2: 118,303,142 (GRCm39) T1504K probably damaging Het
Exoc6b A G 6: 84,828,896 (GRCm39) V496A probably damaging Het
Fam174a A C 1: 95,241,620 (GRCm39) S27R probably benign Het
Fat2 T A 11: 55,182,840 (GRCm39) Q1339L probably benign Het
Fkbpl T A 17: 34,864,797 (GRCm39) D188E possibly damaging Het
Focad A G 4: 88,325,402 (GRCm39) D89G possibly damaging Het
Fstl4 C A 11: 53,077,225 (GRCm39) Q661K probably benign Het
Gck T C 11: 5,853,253 (GRCm39) Y289C probably benign Het
Gm16181 T A 17: 35,442,913 (GRCm39) probably benign Het
Herc1 G A 9: 66,358,073 (GRCm39) G2385S probably damaging Het
Igfn1 T C 1: 135,902,606 (GRCm39) probably null Het
Il12b T C 11: 44,299,353 (GRCm39) W141R probably damaging Het
Itga6 T A 2: 71,664,414 (GRCm39) S517T probably benign Het
Kank1 A G 19: 25,388,813 (GRCm39) S801G probably benign Het
Klrh1 A G 6: 129,752,343 (GRCm39) probably null Het
Lctl A G 9: 64,039,003 (GRCm39) D205G probably damaging Het
Lhx3 A C 2: 26,093,986 (GRCm39) V79G probably damaging Het
Lrrc9 T C 12: 72,543,912 (GRCm39) I1127T probably damaging Het
Ltbp3 A T 19: 5,797,877 (GRCm39) E505D probably benign Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Map6 A G 7: 98,965,083 (GRCm39) S291G probably damaging Het
Mapk7 A G 11: 61,380,239 (GRCm39) F671L probably benign Het
Mau2 A G 8: 70,484,142 (GRCm39) W149R probably damaging Het
Mb21d2 C T 16: 28,647,267 (GRCm39) V236I possibly damaging Het
Mc5r C G 18: 68,471,741 (GRCm39) probably null Het
Mical1 C A 10: 41,361,466 (GRCm39) P797Q probably benign Het
Mnx1 G A 5: 29,679,043 (GRCm39) R347C unknown Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Nlrp2 G T 7: 5,330,715 (GRCm39) C560* probably null Het
Npat T A 9: 53,474,416 (GRCm39) L736H probably damaging Het
Nup155 T A 15: 8,145,010 (GRCm39) V147E probably damaging Het
Nxpe2 A G 9: 48,238,121 (GRCm39) F45L probably benign Het
Obscn T C 11: 58,951,741 (GRCm39) D4370G probably benign Het
Or2d3b A G 7: 106,514,273 (GRCm39) I289M probably damaging Het
Or4a79 T C 2: 89,551,550 (GRCm39) K302E probably benign Het
Or4c35 T C 2: 89,808,671 (GRCm39) L183S probably damaging Het
Or4d10 A G 19: 12,051,183 (GRCm39) V271A probably benign Het
Or52n4 A G 7: 104,294,004 (GRCm39) S190P probably benign Het
Or5g23 T A 2: 85,439,188 (GRCm39) H22L probably benign Het
Or8k3 A C 2: 86,059,072 (GRCm39) M81R probably damaging Het
Pcx T C 19: 4,671,249 (GRCm39) I1157T possibly damaging Het
Pias2 T A 18: 77,240,412 (GRCm39) S589R probably benign Het
Plcb1 T C 2: 135,186,093 (GRCm39) F687L probably benign Het
Plk5 G T 10: 80,196,403 (GRCm39) probably null Het
Pnpla2 T A 7: 141,035,329 (GRCm39) Y44N probably damaging Het
Ppp1r12a T A 10: 108,098,292 (GRCm39) D337E possibly damaging Het
Prl2c5 G T 13: 13,365,358 (GRCm39) probably null Het
Prom2 T C 2: 127,378,514 (GRCm39) D460G probably damaging Het
Pros1 A G 16: 62,748,498 (GRCm39) H657R possibly damaging Het
Prune2 A G 19: 17,100,856 (GRCm39) E2120G probably damaging Het
Rap2a T A 14: 120,716,347 (GRCm39) L70Q probably damaging Het
Rbl2 A T 8: 91,839,157 (GRCm39) E858D probably benign Het
Rbm48 T C 5: 3,645,997 (GRCm39) Y69C probably damaging Het
Rgs12 T A 5: 35,123,018 (GRCm39) I267N probably damaging Het
Rpusd2 G T 2: 118,865,728 (GRCm39) A142S probably benign Het
Rspo2 A T 15: 42,939,332 (GRCm39) W153R probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Serinc5 T A 13: 92,842,771 (GRCm39) M407K probably damaging Het
Slain2 T C 5: 73,114,665 (GRCm39) S299P probably damaging Het
Slc17a4 A G 13: 24,084,528 (GRCm39) Y419H possibly damaging Het
Slc1a6 T A 10: 78,627,183 (GRCm39) D173E probably damaging Het
Slc22a19 A T 19: 7,688,506 (GRCm39) I18N probably damaging Het
Slc37a3 A T 6: 39,336,902 (GRCm39) F91L probably damaging Het
Spag5 C A 11: 78,195,281 (GRCm39) T196K possibly damaging Het
Susd2 G T 10: 75,475,566 (GRCm39) A326D probably damaging Het
Syna G T 5: 134,588,769 (GRCm39) A60D probably damaging Het
Tchh A T 3: 93,355,067 (GRCm39) E1502D unknown Het
Tecta T C 9: 42,303,320 (GRCm39) H104R probably damaging Het
Tmed1 T C 9: 21,420,387 (GRCm39) D102G probably damaging Het
Trip12 T C 1: 84,722,781 (GRCm39) D128G probably damaging Het
Uroc1 A G 6: 90,338,506 (GRCm39) M656V probably benign Het
Usp47 T A 7: 111,701,077 (GRCm39) V1096D possibly damaging Het
Utp20 T A 10: 88,598,632 (GRCm39) K115* probably null Het
Vmn2r86 A T 10: 130,282,255 (GRCm39) V787D probably damaging Het
Vmn2r87 A T 10: 130,308,441 (GRCm39) I599N possibly damaging Het
Vwf A G 6: 125,644,492 (GRCm39) D2449G possibly damaging Het
Zbtb7c T A 18: 76,269,977 (GRCm39) C22S probably benign Het
Zc3h7a A G 16: 10,965,168 (GRCm39) I655T possibly damaging Het
Zfp764l1 A G 7: 126,992,503 (GRCm39) W36R probably damaging Het
Other mutations in Vmn2r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Vmn2r19 APN 6 123,306,826 (GRCm39) missense possibly damaging 0.92
IGL02294:Vmn2r19 APN 6 123,306,937 (GRCm39) missense probably benign 0.19
IGL02442:Vmn2r19 APN 6 123,286,621 (GRCm39) missense possibly damaging 0.94
IGL02871:Vmn2r19 APN 6 123,313,042 (GRCm39) missense probably damaging 1.00
H8562:Vmn2r19 UTSW 6 123,292,861 (GRCm39) missense possibly damaging 0.82
R0025:Vmn2r19 UTSW 6 123,308,506 (GRCm39) missense probably benign 0.01
R0389:Vmn2r19 UTSW 6 123,312,945 (GRCm39) missense possibly damaging 0.53
R0402:Vmn2r19 UTSW 6 123,313,141 (GRCm39) missense probably damaging 1.00
R0411:Vmn2r19 UTSW 6 123,286,703 (GRCm39) missense probably damaging 0.98
R0554:Vmn2r19 UTSW 6 123,313,102 (GRCm39) missense probably damaging 0.99
R0578:Vmn2r19 UTSW 6 123,312,931 (GRCm39) missense probably damaging 1.00
R1102:Vmn2r19 UTSW 6 123,313,132 (GRCm39) missense probably benign 0.28
R1652:Vmn2r19 UTSW 6 123,292,656 (GRCm39) missense possibly damaging 0.68
R1663:Vmn2r19 UTSW 6 123,313,411 (GRCm39) missense probably benign 0.11
R1817:Vmn2r19 UTSW 6 123,307,011 (GRCm39) missense possibly damaging 0.80
R1928:Vmn2r19 UTSW 6 123,308,589 (GRCm39) missense probably damaging 1.00
R1997:Vmn2r19 UTSW 6 123,292,880 (GRCm39) missense probably damaging 0.98
R2013:Vmn2r19 UTSW 6 123,292,954 (GRCm39) missense probably benign 0.01
R2015:Vmn2r19 UTSW 6 123,292,954 (GRCm39) missense probably benign 0.01
R2088:Vmn2r19 UTSW 6 123,312,795 (GRCm39) missense probably damaging 1.00
R2126:Vmn2r19 UTSW 6 123,293,033 (GRCm39) missense possibly damaging 0.82
R2128:Vmn2r19 UTSW 6 123,285,289 (GRCm39) splice site probably null
R2256:Vmn2r19 UTSW 6 123,306,845 (GRCm39) missense probably benign 0.20
R2517:Vmn2r19 UTSW 6 123,306,937 (GRCm39) missense probably benign 0.19
R3753:Vmn2r19 UTSW 6 123,292,548 (GRCm39) missense possibly damaging 0.80
R3817:Vmn2r19 UTSW 6 123,286,601 (GRCm39) missense probably damaging 1.00
R3929:Vmn2r19 UTSW 6 123,292,587 (GRCm39) missense probably benign 0.01
R3934:Vmn2r19 UTSW 6 123,292,628 (GRCm39) missense probably damaging 1.00
R4232:Vmn2r19 UTSW 6 123,306,871 (GRCm39) missense probably benign
R4574:Vmn2r19 UTSW 6 123,292,939 (GRCm39) missense probably benign 0.01
R4886:Vmn2r19 UTSW 6 123,286,800 (GRCm39) missense probably benign 0.05
R4995:Vmn2r19 UTSW 6 123,306,869 (GRCm39) missense probably benign 0.00
R5107:Vmn2r19 UTSW 6 123,286,602 (GRCm39) nonsense probably null
R5232:Vmn2r19 UTSW 6 123,312,916 (GRCm39) missense probably benign
R6102:Vmn2r19 UTSW 6 123,306,907 (GRCm39) missense probably damaging 1.00
R6105:Vmn2r19 UTSW 6 123,293,054 (GRCm39) missense possibly damaging 0.70
R6280:Vmn2r19 UTSW 6 123,313,212 (GRCm39) missense probably benign
R6393:Vmn2r19 UTSW 6 123,293,112 (GRCm39) missense possibly damaging 0.80
R6502:Vmn2r19 UTSW 6 123,293,067 (GRCm39) missense possibly damaging 0.68
R6617:Vmn2r19 UTSW 6 123,313,494 (GRCm39) makesense probably null
R6742:Vmn2r19 UTSW 6 123,306,917 (GRCm39) missense possibly damaging 0.90
R7662:Vmn2r19 UTSW 6 123,308,521 (GRCm39) missense probably benign 0.33
R8041:Vmn2r19 UTSW 6 123,312,750 (GRCm39) missense possibly damaging 0.94
R8054:Vmn2r19 UTSW 6 123,292,998 (GRCm39) missense probably damaging 1.00
R8074:Vmn2r19 UTSW 6 123,312,904 (GRCm39) missense probably damaging 0.96
R8267:Vmn2r19 UTSW 6 123,313,221 (GRCm39) missense possibly damaging 0.50
R8287:Vmn2r19 UTSW 6 123,308,588 (GRCm39) missense probably damaging 1.00
R8937:Vmn2r19 UTSW 6 123,293,283 (GRCm39) critical splice donor site probably null
R9058:Vmn2r19 UTSW 6 123,313,021 (GRCm39) missense possibly damaging 0.53
R9119:Vmn2r19 UTSW 6 123,292,527 (GRCm39) missense possibly damaging 0.68
R9384:Vmn2r19 UTSW 6 123,292,923 (GRCm39) missense probably benign 0.00
X0058:Vmn2r19 UTSW 6 123,285,308 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r19 UTSW 6 123,285,298 (GRCm39) missense probably benign 0.02
Z1177:Vmn2r19 UTSW 6 123,313,036 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTACTGAAATCTACCATTTGGATG -3'
(R):5'- TTGAGACCAATCTGGACAAGC -3'

Sequencing Primer
(F):5'- GTCAAAGTTGTCCACTTGG -3'
(R):5'- AGAGATTCACCCATTGAGCTCTGG -3'
Posted On 2014-06-30