Incidental Mutation 'R1866:Vmn2r19'
ID208718
Institutional Source Beutler Lab
Gene Symbol Vmn2r19
Ensembl Gene ENSMUSG00000091260
Gene Namevomeronasal 2, receptor 19
SynonymsEG232358
MMRRC Submission 039889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1866 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location123308333-123336537 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 123331638 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073948]
Predicted Effect probably null
Transcript: ENSMUST00000073948
SMART Domains Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 476 2.9e-35 PFAM
Pfam:NCD3G 518 571 8.3e-23 PFAM
Pfam:7tm_3 603 839 7.2e-52 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 A T 19: 23,892,831 E9V probably benign Het
Armc8 T A 9: 99,536,280 T32S probably benign Het
Atr T A 9: 95,870,605 probably null Het
Blm A G 7: 80,494,114 L859P probably benign Het
Cacna2d3 A T 14: 28,969,214 F51L probably damaging Het
Cdcp2 A G 4: 107,107,000 N349S probably damaging Het
Cfap57 G A 4: 118,599,927 H442Y possibly damaging Het
Chrm3 A G 13: 9,878,481 L173P probably damaging Het
Cpb1 C G 3: 20,263,756 M201I probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Dnah3 A T 7: 119,928,856 probably null Het
Dnah6 T A 6: 73,100,088 Q2398L probably benign Het
Dpep2 A T 8: 105,989,448 probably null Het
E430018J23Rik A G 7: 127,393,331 W36R probably damaging Het
Eif2ak4 C A 2: 118,472,661 T1504K probably damaging Het
Exoc6b A G 6: 84,851,914 V496A probably damaging Het
Fam174a A C 1: 95,313,895 S27R probably benign Het
Fat2 T A 11: 55,292,014 Q1339L probably benign Het
Fkbpl T A 17: 34,645,823 D188E possibly damaging Het
Focad A G 4: 88,407,165 D89G possibly damaging Het
Fstl4 C A 11: 53,186,398 Q661K probably benign Het
Gck T C 11: 5,903,253 Y289C probably benign Het
Gm156 A G 6: 129,775,380 probably null Het
Gm16181 T A 17: 35,223,937 probably benign Het
Herc1 G A 9: 66,450,791 G2385S probably damaging Het
Igfn1 T C 1: 135,974,868 probably null Het
Il12b T C 11: 44,408,526 W141R probably damaging Het
Itga6 T A 2: 71,834,070 S517T probably benign Het
Kank1 A G 19: 25,411,449 S801G probably benign Het
Lctl A G 9: 64,131,721 D205G probably damaging Het
Lhx3 A C 2: 26,203,974 V79G probably damaging Het
Lrrc9 T C 12: 72,497,138 I1127T probably damaging Het
Ltbp3 A T 19: 5,747,849 E505D probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map6 A G 7: 99,315,876 S291G probably damaging Het
Mapk7 A G 11: 61,489,413 F671L probably benign Het
Mau2 A G 8: 70,031,492 W149R probably damaging Het
Mb21d2 C T 16: 28,828,515 V236I possibly damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Mical1 C A 10: 41,485,470 P797Q probably benign Het
Mnx1 G A 5: 29,474,045 R347C unknown Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nlrp2 G T 7: 5,327,716 C560* probably null Het
Npat T A 9: 53,563,116 L736H probably damaging Het
Nup155 T A 15: 8,115,526 V147E probably damaging Het
Nxpe2 A G 9: 48,326,821 F45L probably benign Het
Obscn T C 11: 59,060,915 D4370G probably benign Het
Olfr1000 T A 2: 85,608,844 H22L probably benign Het
Olfr1047 A C 2: 86,228,728 M81R probably damaging Het
Olfr1252 T C 2: 89,721,206 K302E probably benign Het
Olfr1260 T C 2: 89,978,327 L183S probably damaging Het
Olfr1425 A G 19: 12,073,819 V271A probably benign Het
Olfr1532-ps1 A G 7: 106,915,066 I289M probably damaging Het
Olfr658 A G 7: 104,644,797 S190P probably benign Het
Pcx T C 19: 4,621,221 I1157T possibly damaging Het
Pias2 T A 18: 77,152,716 S589R probably benign Het
Plcb1 T C 2: 135,344,173 F687L probably benign Het
Plk5 G T 10: 80,360,569 probably null Het
Pnpla2 T A 7: 141,455,416 Y44N probably damaging Het
Ppp1r12a T A 10: 108,262,431 D337E possibly damaging Het
Prl2c5 G T 13: 13,190,773 probably null Het
Prom2 T C 2: 127,536,594 D460G probably damaging Het
Pros1 A G 16: 62,928,135 H657R possibly damaging Het
Prune2 A G 19: 17,123,492 E2120G probably damaging Het
Rap2a T A 14: 120,478,935 L70Q probably damaging Het
Rbl2 A T 8: 91,112,529 E858D probably benign Het
Rbm48 T C 5: 3,595,997 Y69C probably damaging Het
Rgs12 T A 5: 34,965,674 I267N probably damaging Het
Rpusd2 G T 2: 119,035,247 A142S probably benign Het
Rspo2 A T 15: 43,075,936 W153R probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Serinc5 T A 13: 92,706,263 M407K probably damaging Het
Slain2 T C 5: 72,957,322 S299P probably damaging Het
Slc17a4 A G 13: 23,900,545 Y419H possibly damaging Het
Slc1a6 T A 10: 78,791,349 D173E probably damaging Het
Slc22a19 A T 19: 7,711,141 I18N probably damaging Het
Slc37a3 A T 6: 39,359,968 F91L probably damaging Het
Spag5 C A 11: 78,304,455 T196K possibly damaging Het
Susd2 G T 10: 75,639,732 A326D probably damaging Het
Syna G T 5: 134,559,915 A60D probably damaging Het
Tchh A T 3: 93,447,760 E1502D unknown Het
Tecta T C 9: 42,392,024 H104R probably damaging Het
Tmed1 T C 9: 21,509,091 D102G probably damaging Het
Trip12 T C 1: 84,745,060 D128G probably damaging Het
Uroc1 A G 6: 90,361,524 M656V probably benign Het
Usp47 T A 7: 112,101,870 V1096D possibly damaging Het
Utp20 T A 10: 88,762,770 K115* probably null Het
Vmn2r86 A T 10: 130,446,386 V787D probably damaging Het
Vmn2r87 A T 10: 130,472,572 I599N possibly damaging Het
Vwf A G 6: 125,667,529 D2449G possibly damaging Het
Zbtb7c T A 18: 76,136,906 C22S probably benign Het
Zc3h7a A G 16: 11,147,304 I655T possibly damaging Het
Other mutations in Vmn2r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Vmn2r19 APN 6 123329867 missense possibly damaging 0.92
IGL02294:Vmn2r19 APN 6 123329978 missense probably benign 0.19
IGL02442:Vmn2r19 APN 6 123309662 missense possibly damaging 0.94
IGL02871:Vmn2r19 APN 6 123336083 missense probably damaging 1.00
H8562:Vmn2r19 UTSW 6 123315902 missense possibly damaging 0.82
R0025:Vmn2r19 UTSW 6 123331547 missense probably benign 0.01
R0389:Vmn2r19 UTSW 6 123335986 missense possibly damaging 0.53
R0402:Vmn2r19 UTSW 6 123336182 missense probably damaging 1.00
R0411:Vmn2r19 UTSW 6 123309744 missense probably damaging 0.98
R0554:Vmn2r19 UTSW 6 123336143 missense probably damaging 0.99
R0578:Vmn2r19 UTSW 6 123335972 missense probably damaging 1.00
R1102:Vmn2r19 UTSW 6 123336173 missense probably benign 0.28
R1652:Vmn2r19 UTSW 6 123315697 missense possibly damaging 0.68
R1663:Vmn2r19 UTSW 6 123336452 missense probably benign 0.11
R1817:Vmn2r19 UTSW 6 123330052 missense possibly damaging 0.80
R1928:Vmn2r19 UTSW 6 123331630 missense probably damaging 1.00
R1997:Vmn2r19 UTSW 6 123315921 missense probably damaging 0.98
R2013:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2015:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2088:Vmn2r19 UTSW 6 123335836 missense probably damaging 1.00
R2126:Vmn2r19 UTSW 6 123316074 missense possibly damaging 0.82
R2128:Vmn2r19 UTSW 6 123308330 unclassified probably null
R2256:Vmn2r19 UTSW 6 123329886 missense probably benign 0.20
R2517:Vmn2r19 UTSW 6 123329978 missense probably benign 0.19
R3753:Vmn2r19 UTSW 6 123315589 missense possibly damaging 0.80
R3817:Vmn2r19 UTSW 6 123309642 missense probably damaging 1.00
R3929:Vmn2r19 UTSW 6 123315628 missense probably benign 0.01
R3934:Vmn2r19 UTSW 6 123315669 missense probably damaging 1.00
R4232:Vmn2r19 UTSW 6 123329912 missense probably benign
R4574:Vmn2r19 UTSW 6 123315980 missense probably benign 0.01
R4886:Vmn2r19 UTSW 6 123309841 missense probably benign 0.05
R4995:Vmn2r19 UTSW 6 123329910 missense probably benign 0.00
R5107:Vmn2r19 UTSW 6 123309643 nonsense probably null
R5232:Vmn2r19 UTSW 6 123335957 missense probably benign
R6102:Vmn2r19 UTSW 6 123329948 missense probably damaging 1.00
R6105:Vmn2r19 UTSW 6 123316095 missense possibly damaging 0.70
R6280:Vmn2r19 UTSW 6 123336253 missense probably benign
R6393:Vmn2r19 UTSW 6 123316153 missense possibly damaging 0.80
R6502:Vmn2r19 UTSW 6 123316108 missense possibly damaging 0.68
R6617:Vmn2r19 UTSW 6 123336535 makesense probably null
R6742:Vmn2r19 UTSW 6 123329958 missense possibly damaging 0.90
R7662:Vmn2r19 UTSW 6 123331562 missense probably benign 0.33
R8041:Vmn2r19 UTSW 6 123335791 missense possibly damaging 0.94
R8054:Vmn2r19 UTSW 6 123316039 missense probably damaging 1.00
R8074:Vmn2r19 UTSW 6 123335945 missense probably damaging 0.96
R8267:Vmn2r19 UTSW 6 123336262 missense possibly damaging 0.50
R8287:Vmn2r19 UTSW 6 123331629 missense probably damaging 1.00
X0058:Vmn2r19 UTSW 6 123308349 missense probably benign 0.00
Z1088:Vmn2r19 UTSW 6 123308339 missense probably benign 0.02
Z1177:Vmn2r19 UTSW 6 123336077 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTACTGAAATCTACCATTTGGATG -3'
(R):5'- TTGAGACCAATCTGGACAAGC -3'

Sequencing Primer
(F):5'- GTCAAAGTTGTCCACTTGG -3'
(R):5'- AGAGATTCACCCATTGAGCTCTGG -3'
Posted On2014-06-30