Incidental Mutation 'R0117:Rbak'
ID20872
Institutional Source Beutler Lab
Gene Symbol Rbak
Ensembl Gene ENSMUSG00000061898
Gene NameRB-associated KRAB zinc finger
Synonyms
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0117 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location143172186-143180775 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 143173632 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 555 (Y555*)
Ref Sequence ENSEMBL: ENSMUSP00000128731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049861] [ENSMUST00000165318]
Predicted Effect probably null
Transcript: ENSMUST00000049861
AA Change: Y555*
SMART Domains Protein: ENSMUSP00000059273
Gene: ENSMUSG00000061898
AA Change: Y555*

DomainStartEndE-ValueType
KRAB 8 68 6.89e-36 SMART
ZnF_C2H2 258 280 1.1e-2 SMART
ZnF_C2H2 286 308 1.4e-4 SMART
ZnF_C2H2 314 336 5.21e-4 SMART
ZnF_C2H2 342 364 1.95e-3 SMART
ZnF_C2H2 370 392 2.3e-5 SMART
ZnF_C2H2 398 420 3.95e-4 SMART
ZnF_C2H2 426 448 5.59e-4 SMART
ZnF_C2H2 454 476 1.12e-3 SMART
ZnF_C2H2 508 528 1.4e1 SMART
ZnF_C2H2 536 558 3.89e-3 SMART
ZnF_C2H2 564 586 1.04e-3 SMART
ZnF_C2H2 592 614 5.42e-2 SMART
ZnF_C2H2 620 642 1.5e-4 SMART
ZnF_C2H2 648 670 9.22e-5 SMART
ZnF_C2H2 676 698 5.21e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165318
AA Change: Y555*
SMART Domains Protein: ENSMUSP00000128731
Gene: ENSMUSG00000061898
AA Change: Y555*

DomainStartEndE-ValueType
KRAB 8 68 6.89e-36 SMART
ZnF_C2H2 258 280 1.1e-2 SMART
ZnF_C2H2 286 308 1.4e-4 SMART
ZnF_C2H2 314 336 5.21e-4 SMART
ZnF_C2H2 342 364 1.95e-3 SMART
ZnF_C2H2 370 392 2.3e-5 SMART
ZnF_C2H2 398 420 3.95e-4 SMART
ZnF_C2H2 426 448 5.59e-4 SMART
ZnF_C2H2 454 476 1.12e-3 SMART
ZnF_C2H2 508 528 1.4e1 SMART
ZnF_C2H2 536 558 3.89e-3 SMART
ZnF_C2H2 564 586 1.04e-3 SMART
ZnF_C2H2 592 614 5.42e-2 SMART
ZnF_C2H2 620 642 1.5e-4 SMART
ZnF_C2H2 648 670 9.22e-5 SMART
ZnF_C2H2 676 698 5.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166382
SMART Domains Protein: ENSMUSP00000132239
Gene: ENSMUSG00000061898

DomainStartEndE-ValueType
KRAB 27 87 6.89e-36 SMART
ZnF_C2H2 277 299 1.1e-2 SMART
ZnF_C2H2 305 327 1.4e-4 SMART
ZnF_C2H2 333 355 5.21e-4 SMART
ZnF_C2H2 361 383 1.95e-3 SMART
ZnF_C2H2 389 411 2.3e-5 SMART
ZnF_C2H2 417 439 3.95e-4 SMART
ZnF_C2H2 445 467 5.59e-4 SMART
ZnF_C2H2 473 495 1.12e-3 SMART
ZnF_C2H2 527 547 1.4e1 SMART
ZnF_C2H2 555 577 3.89e-3 SMART
ZnF_C2H2 583 605 1.04e-3 SMART
ZnF_C2H2 611 633 5.42e-2 SMART
ZnF_C2H2 639 661 1.5e-4 SMART
ZnF_C2H2 667 689 9.22e-5 SMART
ZnF_C2H2 695 717 5.21e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which interacts with the tumor suppressor retinoblastoma 1. The two interacting proteins are thought to act as a transcriptional repressor for promoters which are activated by the E2F1 transcription factor. This protein contains a Kruppel-associated box (KRAB), which is a transcriptional repressor motif. Read-through transcripts that include exons from the downstream gene LOC389458 are expressed from this locus. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Rbak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Rbak APN 5 143176600 splice site probably benign
BB001:Rbak UTSW 5 143174486 missense probably damaging 1.00
BB011:Rbak UTSW 5 143174486 missense probably damaging 1.00
R0514:Rbak UTSW 5 143173414 missense probably damaging 0.96
R0945:Rbak UTSW 5 143173579 missense probably damaging 1.00
R1483:Rbak UTSW 5 143174344 missense probably damaging 1.00
R1796:Rbak UTSW 5 143173447 missense probably damaging 1.00
R1916:Rbak UTSW 5 143176116 missense probably damaging 1.00
R1960:Rbak UTSW 5 143174682 nonsense probably null
R2039:Rbak UTSW 5 143173175 missense probably benign 0.37
R2070:Rbak UTSW 5 143176584 missense probably damaging 0.99
R2071:Rbak UTSW 5 143176584 missense probably damaging 0.99
R2151:Rbak UTSW 5 143176502 missense possibly damaging 0.65
R2877:Rbak UTSW 5 143174105 missense probably damaging 1.00
R4030:Rbak UTSW 5 143173969 missense probably damaging 1.00
R4584:Rbak UTSW 5 143176123 missense probably benign 0.00
R4612:Rbak UTSW 5 143174467 missense probably benign 0.01
R5229:Rbak UTSW 5 143174162 missense probably damaging 1.00
R5518:Rbak UTSW 5 143173309 missense probably damaging 1.00
R5541:Rbak UTSW 5 143173990 missense probably damaging 1.00
R5873:Rbak UTSW 5 143173711 missense probably benign 0.32
R5908:Rbak UTSW 5 143173636 missense probably damaging 1.00
R6053:Rbak UTSW 5 143174682 nonsense probably null
R6416:Rbak UTSW 5 143176552 missense possibly damaging 0.67
R6693:Rbak UTSW 5 143174111 missense probably damaging 0.97
R7041:Rbak UTSW 5 143173471 missense probably damaging 1.00
R7057:Rbak UTSW 5 143173927 missense possibly damaging 0.81
R7341:Rbak UTSW 5 143176072 missense probably benign 0.01
R7454:Rbak UTSW 5 143173773 nonsense probably null
R7921:Rbak UTSW 5 143174262 missense probably damaging 0.97
R7924:Rbak UTSW 5 143174486 missense probably damaging 1.00
R8939:Rbak UTSW 5 143174270 missense possibly damaging 0.55
Z1176:Rbak UTSW 5 143176547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTACGGTGAGGTTCGACATCC -3'
(R):5'- CATTAGGCACTGGAAGGTCCATGC -3'

Sequencing Primer
(F):5'- gcgagaacactttcccacac -3'
(R):5'- TGTGCCCCTGATCACACAG -3'
Posted On2013-04-11