Incidental Mutation 'R1866:Map6'
ID 208723
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 039889-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R1866 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98965083 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 291 (S291G)
Ref Sequence ENSEMBL: ENSMUSP00000146954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: S494G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: S494G

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107100
AA Change: S291G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407
AA Change: S291G

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000122101
AA Change: S494G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: S494G

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: S494G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: S494G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208605
AA Change: S291G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208924
AA Change: S291G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209094
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 A T 19: 23,870,195 (GRCm39) E9V probably benign Het
Armc8 T A 9: 99,418,333 (GRCm39) T32S probably benign Het
Atr T A 9: 95,752,658 (GRCm39) probably null Het
Blm A G 7: 80,143,862 (GRCm39) L859P probably benign Het
Cacna2d3 A T 14: 28,691,171 (GRCm39) F51L probably damaging Het
Cdcp2 A G 4: 106,964,197 (GRCm39) N349S probably damaging Het
Cfap57 G A 4: 118,457,124 (GRCm39) H442Y possibly damaging Het
Chrm3 A G 13: 9,928,517 (GRCm39) L173P probably damaging Het
Cpb1 C G 3: 20,317,920 (GRCm39) M201I probably benign Het
Dgcr8 A T 16: 18,076,178 (GRCm39) N2K probably damaging Het
Dnah3 A T 7: 119,528,079 (GRCm39) probably null Het
Dnah6 T A 6: 73,077,071 (GRCm39) Q2398L probably benign Het
Dpep2 A T 8: 106,716,080 (GRCm39) probably null Het
Eif2ak4 C A 2: 118,303,142 (GRCm39) T1504K probably damaging Het
Exoc6b A G 6: 84,828,896 (GRCm39) V496A probably damaging Het
Fam174a A C 1: 95,241,620 (GRCm39) S27R probably benign Het
Fat2 T A 11: 55,182,840 (GRCm39) Q1339L probably benign Het
Fkbpl T A 17: 34,864,797 (GRCm39) D188E possibly damaging Het
Focad A G 4: 88,325,402 (GRCm39) D89G possibly damaging Het
Fstl4 C A 11: 53,077,225 (GRCm39) Q661K probably benign Het
Gck T C 11: 5,853,253 (GRCm39) Y289C probably benign Het
Gm16181 T A 17: 35,442,913 (GRCm39) probably benign Het
Herc1 G A 9: 66,358,073 (GRCm39) G2385S probably damaging Het
Igfn1 T C 1: 135,902,606 (GRCm39) probably null Het
Il12b T C 11: 44,299,353 (GRCm39) W141R probably damaging Het
Itga6 T A 2: 71,664,414 (GRCm39) S517T probably benign Het
Kank1 A G 19: 25,388,813 (GRCm39) S801G probably benign Het
Klrh1 A G 6: 129,752,343 (GRCm39) probably null Het
Lctl A G 9: 64,039,003 (GRCm39) D205G probably damaging Het
Lhx3 A C 2: 26,093,986 (GRCm39) V79G probably damaging Het
Lrrc9 T C 12: 72,543,912 (GRCm39) I1127T probably damaging Het
Ltbp3 A T 19: 5,797,877 (GRCm39) E505D probably benign Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mapk7 A G 11: 61,380,239 (GRCm39) F671L probably benign Het
Mau2 A G 8: 70,484,142 (GRCm39) W149R probably damaging Het
Mb21d2 C T 16: 28,647,267 (GRCm39) V236I possibly damaging Het
Mc5r C G 18: 68,471,741 (GRCm39) probably null Het
Mical1 C A 10: 41,361,466 (GRCm39) P797Q probably benign Het
Mnx1 G A 5: 29,679,043 (GRCm39) R347C unknown Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Nlrp2 G T 7: 5,330,715 (GRCm39) C560* probably null Het
Npat T A 9: 53,474,416 (GRCm39) L736H probably damaging Het
Nup155 T A 15: 8,145,010 (GRCm39) V147E probably damaging Het
Nxpe2 A G 9: 48,238,121 (GRCm39) F45L probably benign Het
Obscn T C 11: 58,951,741 (GRCm39) D4370G probably benign Het
Or2d3b A G 7: 106,514,273 (GRCm39) I289M probably damaging Het
Or4a79 T C 2: 89,551,550 (GRCm39) K302E probably benign Het
Or4c35 T C 2: 89,808,671 (GRCm39) L183S probably damaging Het
Or4d10 A G 19: 12,051,183 (GRCm39) V271A probably benign Het
Or52n4 A G 7: 104,294,004 (GRCm39) S190P probably benign Het
Or5g23 T A 2: 85,439,188 (GRCm39) H22L probably benign Het
Or8k3 A C 2: 86,059,072 (GRCm39) M81R probably damaging Het
Pcx T C 19: 4,671,249 (GRCm39) I1157T possibly damaging Het
Pias2 T A 18: 77,240,412 (GRCm39) S589R probably benign Het
Plcb1 T C 2: 135,186,093 (GRCm39) F687L probably benign Het
Plk5 G T 10: 80,196,403 (GRCm39) probably null Het
Pnpla2 T A 7: 141,035,329 (GRCm39) Y44N probably damaging Het
Ppp1r12a T A 10: 108,098,292 (GRCm39) D337E possibly damaging Het
Prl2c5 G T 13: 13,365,358 (GRCm39) probably null Het
Prom2 T C 2: 127,378,514 (GRCm39) D460G probably damaging Het
Pros1 A G 16: 62,748,498 (GRCm39) H657R possibly damaging Het
Prune2 A G 19: 17,100,856 (GRCm39) E2120G probably damaging Het
Rap2a T A 14: 120,716,347 (GRCm39) L70Q probably damaging Het
Rbl2 A T 8: 91,839,157 (GRCm39) E858D probably benign Het
Rbm48 T C 5: 3,645,997 (GRCm39) Y69C probably damaging Het
Rgs12 T A 5: 35,123,018 (GRCm39) I267N probably damaging Het
Rpusd2 G T 2: 118,865,728 (GRCm39) A142S probably benign Het
Rspo2 A T 15: 42,939,332 (GRCm39) W153R probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Serinc5 T A 13: 92,842,771 (GRCm39) M407K probably damaging Het
Slain2 T C 5: 73,114,665 (GRCm39) S299P probably damaging Het
Slc17a4 A G 13: 24,084,528 (GRCm39) Y419H possibly damaging Het
Slc1a6 T A 10: 78,627,183 (GRCm39) D173E probably damaging Het
Slc22a19 A T 19: 7,688,506 (GRCm39) I18N probably damaging Het
Slc37a3 A T 6: 39,336,902 (GRCm39) F91L probably damaging Het
Spag5 C A 11: 78,195,281 (GRCm39) T196K possibly damaging Het
Susd2 G T 10: 75,475,566 (GRCm39) A326D probably damaging Het
Syna G T 5: 134,588,769 (GRCm39) A60D probably damaging Het
Tchh A T 3: 93,355,067 (GRCm39) E1502D unknown Het
Tecta T C 9: 42,303,320 (GRCm39) H104R probably damaging Het
Tmed1 T C 9: 21,420,387 (GRCm39) D102G probably damaging Het
Trip12 T C 1: 84,722,781 (GRCm39) D128G probably damaging Het
Uroc1 A G 6: 90,338,506 (GRCm39) M656V probably benign Het
Usp47 T A 7: 111,701,077 (GRCm39) V1096D possibly damaging Het
Utp20 T A 10: 88,598,632 (GRCm39) K115* probably null Het
Vmn2r19 G T 6: 123,308,597 (GRCm39) probably null Het
Vmn2r86 A T 10: 130,282,255 (GRCm39) V787D probably damaging Het
Vmn2r87 A T 10: 130,308,441 (GRCm39) I599N possibly damaging Het
Vwf A G 6: 125,644,492 (GRCm39) D2449G possibly damaging Het
Zbtb7c T A 18: 76,269,977 (GRCm39) C22S probably benign Het
Zc3h7a A G 16: 10,965,168 (GRCm39) I655T possibly damaging Het
Zfp764l1 A G 7: 126,992,503 (GRCm39) W36R probably damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACATCAAGCCTGTGAAAC -3'
(R):5'- CCAGGGTGAGGCTTTTCATTTC -3'

Sequencing Primer
(F):5'- TCAAGCCTGTGAAACCCATC -3'
(R):5'- TGTGCCAAATGTTAAGCCGC -3'
Posted On 2014-06-30