Incidental Mutation 'R0117:Psmc4'
ID20874
Institutional Source Beutler Lab
Gene Symbol Psmc4
Ensembl Gene ENSMUSG00000030603
Gene Nameproteasome (prosome, macropain) 26S subunit, ATPase, 4
SynonymsCIP21, MIP224, CAR interacting protein 21
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0117 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28041707-28050101 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 28042740 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032824] [ENSMUST00000140053]
Predicted Effect probably benign
Transcript: ENSMUST00000032824
SMART Domains Protein: ENSMUSP00000032824
Gene: ENSMUSG00000030603

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
Blast:AAA 96 156 2e-31 BLAST
AAA 198 337 2.6e-24 SMART
Blast:AAA 368 418 7e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138512
Predicted Effect probably benign
Transcript: ENSMUST00000140053
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the triple-A family of ATPases that is a component of the 19S regulatory subunit and plays a role in 26S proteasome assembly. The encoded protein interacts with gankyrin, a liver oncoprotein, and may also play a role in Parkinson's disease through interactions with synphilin-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos. Mice heterozygous for a knock-out allele and a conditional allele activated in motor neurons develop ALS-like symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Phldb1 T C 9: 44,711,706 M1V probably null Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Psmc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03023:Psmc4 APN 7 28042860 missense possibly damaging 0.85
IGL03054:Psmc4 UTSW 7 28047180 missense probably damaging 1.00
R0725:Psmc4 UTSW 7 28048862 missense probably benign
R1371:Psmc4 UTSW 7 28042797 splice site probably benign
R2063:Psmc4 UTSW 7 28048897 missense probably damaging 0.97
R4833:Psmc4 UTSW 7 28047512 missense probably damaging 1.00
R5942:Psmc4 UTSW 7 28047055 missense probably damaging 1.00
R7307:Psmc4 UTSW 7 28042660 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGATTACCTGGCACAGGGAGGAAC -3'
(R):5'- TTCCGCCTAGCTAAGGAGAATGCAC -3'

Sequencing Primer
(F):5'- CACAGGGAGGAACCAGCTTAG -3'
(R):5'- GGAGAATGCACCTGCCATC -3'
Posted On2013-04-11