Incidental Mutation 'R1867:Fmn1'
ID208796
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R1867 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113709438 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1326 (E1326G)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect probably damaging
Transcript: ENSMUST00000081349
AA Change: E1198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: E1198G

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099576
AA Change: E1424G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: E1424G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102547
AA Change: E1460G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: E1460G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153151
Predicted Effect probably damaging
Transcript: ENSMUST00000161731
AA Change: E1326G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: E1326G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A T 5: 66,000,217 M1K probably null Het
Abca4 T A 3: 122,105,361 I664N probably damaging Het
Acin1 T C 14: 54,644,261 D335G probably damaging Het
Acoxl A G 2: 127,877,787 Y156C probably damaging Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Ago1 A G 4: 126,441,236 Y398H probably damaging Het
Aldob A G 4: 49,543,835 V49A possibly damaging Het
Arhgap18 A G 10: 26,846,030 E71G probably damaging Het
Asb12 G T X: 95,470,344 H307N probably damaging Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
AY358078 T C 14: 51,800,047 M1T probably null Het
BC117090 T G 16: 36,321,786 D76A possibly damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Brpf3 A G 17: 28,807,368 M472V probably benign Het
Bsn A G 9: 108,106,719 S3379P unknown Het
Cap2 T C 13: 46,640,079 V333A probably damaging Het
Ccdc173 A T 2: 69,781,837 probably null Het
Cd207 T A 6: 83,675,653 D165V probably damaging Het
Cmtr1 A G 17: 29,674,174 T496A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Cstb A G 10: 78,427,439 *99W probably null Het
Ddx11 G A 17: 66,135,939 probably null Het
Dip2c T C 13: 9,621,949 M990T possibly damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Focad A T 4: 88,178,089 D236V probably damaging Het
Fsd1 G A 17: 55,991,254 S193N probably benign Het
Gm4922 T A 10: 18,784,463 R170S possibly damaging Het
Gm5129 T C 5: 29,735,656 probably benign Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Hspbap1 A T 16: 35,801,564 Y93F possibly damaging Het
Iars2 A T 1: 185,318,568 D441E probably benign Het
Il1rap A T 16: 26,722,926 H639L probably damaging Het
Inhbc A T 10: 127,357,547 V200E probably benign Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Intu G T 3: 40,664,335 G257V probably damaging Het
Kif23 C A 9: 61,918,961 A929S possibly damaging Het
Kmt2b A T 7: 30,574,658 V2207E possibly damaging Het
Ksr2 A C 5: 117,505,529 E121A probably benign Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lpl TGG TG 8: 68,896,602 probably null Het
Mcmdc2 T C 1: 9,930,805 V435A probably damaging Het
Mecom A G 3: 30,509,428 probably null Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mmp16 A T 4: 18,116,013 D539V probably benign Het
Mpp1 A G X: 75,125,369 probably null Het
Mpp2 C T 11: 102,064,667 E86K probably benign Het
Mtor T A 4: 148,454,632 F195L probably damaging Het
Myo3a T C 2: 22,399,846 I663T probably benign Het
Nlrp5 G A 7: 23,423,982 G756E possibly damaging Het
Nudt18 T C 14: 70,579,895 L255P probably damaging Het
Nup62 T A 7: 44,829,048 S162R possibly damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr659 T A 7: 104,671,317 I205N possibly damaging Het
Olfr798 A T 10: 129,625,752 I103K probably damaging Het
Olfr835 G A 9: 19,035,266 A48T probably benign Het
Oosp2 C T 19: 11,649,595 probably null Het
Pan2 A G 10: 128,313,181 D506G probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Pcdhgc5 T G 18: 37,821,418 S582A possibly damaging Het
Pdik1l T C 4: 134,278,911 D70G probably damaging Het
Peg12 T C 7: 62,463,668 H227R probably benign Het
Pms1 C T 1: 53,189,387 V901I probably benign Het
Pnisr C T 4: 21,874,086 probably benign Het
Pole A G 5: 110,334,197 E135G probably benign Het
Ppp6r2 C A 15: 89,281,938 A715E probably benign Het
Prickle4 T G 17: 47,690,119 H174P possibly damaging Het
Prl2a1 T C 13: 27,804,940 L16P probably damaging Het
Prss32 C T 17: 23,853,894 T33M probably benign Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Rbbp6 T C 7: 122,997,029 V598A probably damaging Het
Rbm34 C A 8: 126,970,881 A27S probably benign Het
Rbm4b A G 19: 4,762,303 T247A probably benign Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Sema4f T C 6: 82,917,843 D457G possibly damaging Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Serpina3a A T 12: 104,118,627 I94L probably benign Het
Skida1 TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 2: 18,046,344 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Sntg2 T C 12: 30,236,651 N315D probably benign Het
Snx10 T A 6: 51,575,910 V11E probably damaging Het
Spta1 A G 1: 174,219,839 E1683G probably benign Het
Ssc5d A T 7: 4,928,507 R238W probably damaging Het
Ssh1 A T 5: 113,943,451 F617L probably damaging Het
Taf1 T G X: 101,562,957 M1254R probably damaging Het
Tcirg1 A G 19: 3,898,835 L450P probably damaging Het
Ticam1 C A 17: 56,271,718 A126S probably benign Het
Tnxb T A 17: 34,671,847 V388E probably damaging Het
Tomm5 A G 4: 45,107,939 L32P probably damaging Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp28 T G 9: 49,009,194 D240E probably benign Het
Usp34 T C 11: 23,361,593 Y462H possibly damaging Het
Utp14b C A 1: 78,665,431 Q349K probably damaging Het
Utp20 G T 10: 88,749,443 D2586E probably benign Het
Vmn1r173 A G 7: 23,703,235 I298M unknown Het
Vmn1r37 T A 6: 66,731,477 I29K probably benign Het
Vmn2r23 G A 6: 123,702,915 G32D probably damaging Het
Xpo7 A T 14: 70,693,991 F296I probably damaging Het
Zfhx4 A G 3: 5,412,714 E3463G probably damaging Het
Zfp455 G T 13: 67,207,445 R194L probably benign Het
Zfp663 T C 2: 165,352,731 T523A possibly damaging Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7924:Fmn1 UTSW 2 113529465 critical splice donor site probably null
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
RF023:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTGGGACTATCTTTCTCCACAC -3'
(R):5'- GTGGATTGACAAGAGACTTCCC -3'

Sequencing Primer
(F):5'- CCATGTGGTAGGTTGATAGAATCATG -3'
(R):5'- TTCCCAAAGAAGGCACAGG -3'
Posted On2014-06-30