Incidental Mutation 'R0117:Phldb1'
ID20880
Institutional Source Beutler Lab
Gene Symbol Phldb1
Ensembl Gene ENSMUSG00000048537
Gene Namepleckstrin homology like domain, family B, member 1
SynonymsLL5A, D330037A14Rik
MMRRC Submission 038403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R0117 (G1)
Quality Score165
Status Validated (trace)
Chromosome9
Chromosomal Location44686304-44735198 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 44711706 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000120092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034611] [ENSMUST00000123406] [ENSMUST00000134465] [ENSMUST00000138356] [ENSMUST00000144251] [ENSMUST00000147495] [ENSMUST00000148929] [ENSMUST00000154723] [ENSMUST00000156918]
Predicted Effect probably benign
Transcript: ENSMUST00000034611
AA Change: M684V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034611
Gene: ENSMUSG00000048537
AA Change: M684V

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5.01e-5 PROSPERO
internal_repeat_1 401 449 5.01e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1366 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123123
Predicted Effect probably benign
Transcript: ENSMUST00000123406
SMART Domains Protein: ENSMUSP00000114257
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 132 153 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128326
AA Change: M176V
SMART Domains Protein: ENSMUSP00000119966
Gene: ENSMUSG00000048537
AA Change: M176V

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
coiled coil region 357 396 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 493 506 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 564 572 N/A INTRINSIC
coiled coil region 610 679 N/A INTRINSIC
PH 723 827 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134465
AA Change: M684V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117395
Gene: ENSMUSG00000048537
AA Change: M684V

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 8e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 6.75e-5 PROSPERO
internal_repeat_1 401 449 6.75e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 929 950 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
coiled coil region 1103 1172 N/A INTRINSIC
PH 1215 1319 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138356
AA Change: M684V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120208
Gene: ENSMUSG00000048537
AA Change: M684V

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 4.93e-5 PROSPERO
internal_repeat_1 401 449 4.93e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 931 948 N/A INTRINSIC
low complexity region 999 1017 N/A INTRINSIC
low complexity region 1032 1053 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
low complexity region 1159 1167 N/A INTRINSIC
coiled coil region 1206 1286 N/A INTRINSIC
PH 1329 1444 6.01e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000144251
AA Change: M1V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114773
Gene: ENSMUSG00000048537
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
coiled coil region 146 174 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
coiled coil region 225 264 N/A INTRINSIC
low complexity region 289 310 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
low complexity region 416 424 N/A INTRINSIC
coiled coil region 463 532 N/A INTRINSIC
PH 575 679 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147495
AA Change: M684V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122661
Gene: ENSMUSG00000048537
AA Change: M684V

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5e-5 PROSPERO
internal_repeat_1 401 449 5e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1377 6.01e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148344
AA Change: M428V
SMART Domains Protein: ENSMUSP00000121809
Gene: ENSMUSG00000048537
AA Change: M428V

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
internal_repeat_1 66 99 6.7e-6 PROSPERO
internal_repeat_1 146 194 6.7e-6 PROSPERO
low complexity region 204 222 N/A INTRINSIC
low complexity region 335 362 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
coiled coil region 459 542 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
coiled coil region 609 648 N/A INTRINSIC
low complexity region 688 706 N/A INTRINSIC
low complexity region 721 742 N/A INTRINSIC
low complexity region 792 805 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 863 871 N/A INTRINSIC
coiled coil region 909 978 N/A INTRINSIC
PH 1022 1126 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148929
SMART Domains Protein: ENSMUSP00000114533
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 132 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154723
SMART Domains Protein: ENSMUSP00000116987
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
coiled coil region 118 157 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156918
AA Change: M1V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120092
Gene: ENSMUSG00000048537
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
low complexity region 136 146 N/A INTRINSIC
coiled coil region 182 221 N/A INTRINSIC
low complexity region 246 267 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
low complexity region 373 381 N/A INTRINSIC
coiled coil region 420 489 N/A INTRINSIC
PH 532 636 1.31e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214717
Meta Mutation Damage Score 0.0738 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.1%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 A T 17: 33,780,802 I141K probably damaging Het
Bbs10 T A 10: 111,299,333 D102E possibly damaging Het
Btaf1 A G 19: 36,969,968 T486A probably benign Het
Casp8ap2 A G 4: 32,640,817 T624A probably benign Het
Cep192 T C 18: 67,850,737 probably null Het
Cep76 T C 18: 67,626,674 Y323C possibly damaging Het
CK137956 T A 4: 127,946,792 T374S possibly damaging Het
Cyp2b23 A T 7: 26,673,114 F359I probably benign Het
Cyp4f13 G T 17: 32,930,606 H194Q probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eps15 T A 4: 109,382,819 D667E probably damaging Het
Fig4 G A 10: 41,230,041 R716* probably null Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Gm10639 C T 9: 78,304,418 T154I probably damaging Het
Gmpr T A 13: 45,517,084 probably null Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc2 C A 7: 56,213,611 probably benign Het
Htr2a G A 14: 74,645,093 R173H probably damaging Het
Impg2 A G 16: 56,261,642 N979S probably damaging Het
Kcna2 A G 3: 107,105,354 Y417C probably damaging Het
Lmf1 G T 17: 25,655,991 probably benign Het
Lmntd2 G A 7: 141,210,123 R659C possibly damaging Het
Mcm9 A G 10: 53,537,736 V416A possibly damaging Het
Mgarp G T 3: 51,396,712 probably benign Het
Mpp3 G A 11: 102,000,573 P580S probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Ninl G A 2: 150,937,673 R269W probably damaging Het
Olfr1098 T A 2: 86,922,870 I221F probably damaging Het
Olfr27 T A 9: 39,144,850 I250N probably damaging Het
Olfr862 T C 9: 19,884,299 E2G probably damaging Het
Pcnt A T 10: 76,408,727 L1173* probably null Het
Pde6c A G 19: 38,151,531 E314G probably damaging Het
Pkdrej T A 15: 85,816,099 probably null Het
Plch2 T A 4: 154,985,358 probably benign Het
Pld2 G A 11: 70,557,388 R887Q probably benign Het
Plxnb1 A G 9: 109,105,218 D838G possibly damaging Het
Postn C T 3: 54,383,481 probably benign Het
Prl8a8 T A 13: 27,508,490 I172F probably damaging Het
Psmc4 A T 7: 28,042,740 probably benign Het
Rabgap1 T A 2: 37,561,885 probably null Het
Rapgef2 A G 3: 79,079,177 S1017P probably benign Het
Rbak G T 5: 143,173,632 Y555* probably null Het
Serpina1c T G 12: 103,895,012 *414C probably null Het
Sntb1 A G 15: 55,906,353 V80A probably benign Het
Sorl1 A G 9: 42,033,577 V884A probably benign Het
Stmnd1 C A 13: 46,285,486 Q65K possibly damaging Het
Tgm5 C T 2: 121,075,102 probably null Het
Tmem189 A G 2: 167,644,758 probably benign Het
Tubb1 T C 2: 174,457,784 S420P probably benign Het
Tvp23b T C 11: 62,879,604 probably benign Het
Xirp2 C T 2: 67,517,120 A3235V possibly damaging Het
Zc3h15 T C 2: 83,658,083 S122P possibly damaging Het
Other mutations in Phldb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Phldb1 APN 9 44711146 critical splice donor site probably null
IGL01089:Phldb1 APN 9 44707887 nonsense probably null
IGL01374:Phldb1 APN 9 44696167 missense probably damaging 0.98
IGL01654:Phldb1 APN 9 44718357 splice site probably null
IGL02148:Phldb1 APN 9 44696072 missense probably damaging 0.99
IGL02408:Phldb1 APN 9 44715906 missense possibly damaging 0.50
IGL02429:Phldb1 APN 9 44700950 missense probably damaging 1.00
IGL02440:Phldb1 APN 9 44715403 missense probably damaging 0.99
IGL02457:Phldb1 APN 9 44716474 missense probably benign 0.00
IGL02471:Phldb1 APN 9 44711233 missense probably damaging 1.00
IGL02506:Phldb1 APN 9 44710926 missense probably benign 0.00
IGL03335:Phldb1 APN 9 44728069 missense possibly damaging 0.95
PIT4515001:Phldb1 UTSW 9 44715960 missense probably benign 0.00
R0070:Phldb1 UTSW 9 44707904 missense probably damaging 1.00
R0344:Phldb1 UTSW 9 44701667 missense probably benign 0.14
R0364:Phldb1 UTSW 9 44699335 splice site probably benign
R0622:Phldb1 UTSW 9 44715852 missense probably damaging 1.00
R0737:Phldb1 UTSW 9 44699636 missense possibly damaging 0.92
R1449:Phldb1 UTSW 9 44716633 missense probably benign 0.17
R1498:Phldb1 UTSW 9 44701618 missense possibly damaging 0.70
R1633:Phldb1 UTSW 9 44718322 missense probably damaging 1.00
R1647:Phldb1 UTSW 9 44715433 missense probably damaging 1.00
R1692:Phldb1 UTSW 9 44715420 missense probably damaging 1.00
R1749:Phldb1 UTSW 9 44715748 missense probably damaging 1.00
R1797:Phldb1 UTSW 9 44716545 missense probably damaging 0.99
R2012:Phldb1 UTSW 9 44728036 missense possibly damaging 0.67
R2078:Phldb1 UTSW 9 44707979 missense probably damaging 1.00
R2208:Phldb1 UTSW 9 44696131 missense probably damaging 1.00
R2567:Phldb1 UTSW 9 44726025 missense probably damaging 0.99
R2696:Phldb1 UTSW 9 44718288 missense probably damaging 1.00
R3705:Phldb1 UTSW 9 44694394 missense probably damaging 0.97
R4110:Phldb1 UTSW 9 44715831 missense possibly damaging 0.88
R4772:Phldb1 UTSW 9 44711027 missense probably damaging 1.00
R4857:Phldb1 UTSW 9 44696092 missense probably damaging 0.99
R5148:Phldb1 UTSW 9 44704158 missense probably benign 0.04
R5651:Phldb1 UTSW 9 44711903 missense probably damaging 1.00
R5666:Phldb1 UTSW 9 44715781 missense probably damaging 0.97
R5670:Phldb1 UTSW 9 44715781 missense probably damaging 0.97
R5914:Phldb1 UTSW 9 44711651 missense probably damaging 0.97
R6232:Phldb1 UTSW 9 44696117 missense probably damaging 1.00
R6257:Phldb1 UTSW 9 44696140 missense probably damaging 0.99
R6413:Phldb1 UTSW 9 44696143 missense probably damaging 1.00
R6418:Phldb1 UTSW 9 44711900 missense probably damaging 1.00
R6813:Phldb1 UTSW 9 44699568 missense probably damaging 1.00
R6845:Phldb1 UTSW 9 44716062 missense probably damaging 1.00
R7009:Phldb1 UTSW 9 44694408 missense probably damaging 1.00
R7042:Phldb1 UTSW 9 44694424 missense probably damaging 1.00
R7062:Phldb1 UTSW 9 44696135 missense probably damaging 0.99
R7077:Phldb1 UTSW 9 44711904 missense possibly damaging 0.62
R7307:Phldb1 UTSW 9 44694047 missense possibly damaging 0.62
R7995:Phldb1 UTSW 9 44715372 missense probably damaging 1.00
R8108:Phldb1 UTSW 9 44711161 missense probably damaging 1.00
R8433:Phldb1 UTSW 9 44716462 missense probably damaging 1.00
RF020:Phldb1 UTSW 9 44697946 missense probably damaging 1.00
X0020:Phldb1 UTSW 9 44687677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGAAAGGATTTACCAGAGTGCC -3'
(R):5'- TGAACCTGTGTGCTGAGTACAGCC -3'

Sequencing Primer
(F):5'- TGGGAAAGTCATGGTCACCTC -3'
(R):5'- TGAGTACAGCCGAGCTGAC -3'
Posted On2013-04-11