Mutagenetix > Incidental Mutation

Incidental Mutation 'R1867:Intu'

208801

Institutional Source

Beutler Lab

Gene Symbol

Intu

Ensembl Gene

ENSMUSG00000060798

Gene Name

inturned planar cell polarity protein

Synonyms

Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1867 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40531286-40704774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 40664335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 257 (G257V)

Ref Sequence

ENSEMBL: ENSMUSP00000088725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091186]

AlphaFold

Q059U7

Predicted Effect

probably damaging
Transcript: ENSMUST00000091186
AA Change: G257V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: G257V

Domain	Start	End	E-Value	Type
low complexity region	21	48	N/A	INTRINSIC
low complexity region	64	81	N/A	INTRINSIC
PDZ	187	269	2.09e-3	SMART
low complexity region	459	468	N/A	INTRINSIC
low complexity region	774	784	N/A	INTRINSIC

Meta Mutation Damage Score

0.2863

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	T	5: 66,000,217	M1K	probably null	Het
Abca4	T	A	3: 122,105,361	I664N	probably damaging	Het
Acin1	T	C	14: 54,644,261	D335G	probably damaging	Het
Acoxl	A	G	2: 127,877,787	Y156C	probably damaging	Het
Adamts20	A	G	15: 94,338,459	F844L	probably benign	Het
Ago1	A	G	4: 126,441,236	Y398H	probably damaging	Het
Aldob	A	G	4: 49,543,835	V49A	possibly damaging	Het
Arhgap18	A	G	10: 26,846,030	E71G	probably damaging	Het
Asb12	G	T	X: 95,470,344	H307N	probably damaging	Het
Atp2b1	T	C	10: 98,996,888	V417A	probably damaging	Het
AY358078	T	C	14: 51,800,047	M1T	probably null	Het
BC117090	T	G	16: 36,321,786	D76A	possibly damaging	Het
Bcl2l15	A	G	3: 103,838,598		probably null	Het
Brpf3	A	G	17: 28,807,368	M472V	probably benign	Het
Bsn	A	G	9: 108,106,719	S3379P	unknown	Het
Cap2	T	C	13: 46,640,079	V333A	probably damaging	Het
Ccdc173	A	T	2: 69,781,837		probably null	Het
Cd207	T	A	6: 83,675,653	D165V	probably damaging	Het
Cmtr1	A	G	17: 29,674,174	T496A	probably benign	Het
Col14a1	T	A	15: 55,447,462		probably benign	Het
Cstb	A	G	10: 78,427,439	*99W	probably null	Het
Ddx11	G	A	17: 66,135,939		probably null	Het
Dip2c	T	C	13: 9,621,949	M990T	possibly damaging	Het
Epc2	A	G	2: 49,532,105	Y337C	probably damaging	Het
Fmn1	A	G	2: 113,709,438	E1326G	probably damaging	Het
Focad	A	T	4: 88,178,089	D236V	probably damaging	Het
Fsd1	G	A	17: 55,991,254	S193N	probably benign	Het
Gm4922	T	A	10: 18,784,463	R170S	possibly damaging	Het
Gm5129	T	C	5: 29,735,656		probably benign	Het
Gucy2d	T	A	7: 98,454,061	L504H	probably damaging	Het
Hspbap1	A	T	16: 35,801,564	Y93F	possibly damaging	Het
Iars2	A	T	1: 185,318,568	D441E	probably benign	Het
Il1rap	A	T	16: 26,722,926	H639L	probably damaging	Het
Inhbc	A	T	10: 127,357,547	V200E	probably benign	Het
Ints8	C	A	4: 11,241,684	C253F	probably damaging	Het
Kif23	C	A	9: 61,918,961	A929S	possibly damaging	Het
Kmt2b	A	T	7: 30,574,658	V2207E	possibly damaging	Het
Ksr2	A	C	5: 117,505,529	E121A	probably benign	Het
Lce1b	A	G	3: 92,656,011	S72P	unknown	Het
Lpl	TGG	TG	8: 68,896,602		probably null	Het
Mcmdc2	T	C	1: 9,930,805	V435A	probably damaging	Het
Mecom	A	G	3: 30,509,428		probably null	Het
Mier2	A	G	10: 79,548,830	V150A	probably damaging	Het
Mmp16	A	T	4: 18,116,013	D539V	probably benign	Het
Mpp1	A	G	X: 75,125,369		probably null	Het
Mpp2	C	T	11: 102,064,667	E86K	probably benign	Het
Mtor	T	A	4: 148,454,632	F195L	probably damaging	Het
Myo3a	T	C	2: 22,399,846	I663T	probably benign	Het
Nlrp5	G	A	7: 23,423,982	G756E	possibly damaging	Het
Nudt18	T	C	14: 70,579,895	L255P	probably damaging	Het
Nup62	T	A	7: 44,829,048	S162R	possibly damaging	Het
Olfr1097	A	G	2: 86,890,612	S188P	probably damaging	Het
Olfr659	T	A	7: 104,671,317	I205N	possibly damaging	Het
Olfr798	A	T	10: 129,625,752	I103K	probably damaging	Het
Olfr835	G	A	9: 19,035,266	A48T	probably benign	Het
Oosp2	C	T	19: 11,649,595		probably null	Het
Pan2	A	G	10: 128,313,181	D506G	probably damaging	Het
Pcdh9	G	A	14: 93,888,035	S233L	probably damaging	Het
Pcdhgc5	T	G	18: 37,821,418	S582A	possibly damaging	Het
Pdik1l	T	C	4: 134,278,911	D70G	probably damaging	Het
Peg12	T	C	7: 62,463,668	H227R	probably benign	Het
Pms1	C	T	1: 53,189,387	V901I	probably benign	Het
Pnisr	C	T	4: 21,874,086		probably benign	Het
Pole	A	G	5: 110,334,197	E135G	probably benign	Het
Ppp6r2	C	A	15: 89,281,938	A715E	probably benign	Het
Prickle4	T	G	17: 47,690,119	H174P	possibly damaging	Het
Prl2a1	T	C	13: 27,804,940	L16P	probably damaging	Het
Prss32	C	T	17: 23,853,894	T33M	probably benign	Het
Psmd13	C	T	7: 140,883,517	T38I	probably damaging	Het
Rai14	C	A	15: 10,633,228	Q25H	probably damaging	Het
Rbbp6	T	C	7: 122,997,029	V598A	probably damaging	Het
Rbm34	C	A	8: 126,970,881	A27S	probably benign	Het
Rbm4b	A	G	19: 4,762,303	T247A	probably benign	Het
Riiad1	G	A	3: 94,472,869	P40S	possibly damaging	Het
Sema4f	T	C	6: 82,917,843	D457G	possibly damaging	Het
Sema6c	A	T	3: 95,170,788	I492F	probably damaging	Het
Serpina3a	A	T	12: 104,118,627	I94L	probably benign	Het
Skida1	TTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTG	2: 18,046,344		probably benign	Het
Slc38a1	G	A	15: 96,587,135	T221M	probably damaging	Het
Slc6a17	T	A	3: 107,472,176	M559L	probably damaging	Het
Sntg2	T	C	12: 30,236,651	N315D	probably benign	Het
Snx10	T	A	6: 51,575,910	V11E	probably damaging	Het
Spta1	A	G	1: 174,219,839	E1683G	probably benign	Het
Ssc5d	A	T	7: 4,928,507	R238W	probably damaging	Het
Ssh1	A	T	5: 113,943,451	F617L	probably damaging	Het
Taf1	T	G	X: 101,562,957	M1254R	probably damaging	Het
Tcirg1	A	G	19: 3,898,835	L450P	probably damaging	Het
Ticam1	C	A	17: 56,271,718	A126S	probably benign	Het
Tnxb	T	A	17: 34,671,847	V388E	probably damaging	Het
Tomm5	A	G	4: 45,107,939	L32P	probably damaging	Het
Ubr5	A	T	15: 38,041,846	S169T	probably benign	Het
Usp28	T	G	9: 49,009,194	D240E	probably benign	Het
Usp34	T	C	11: 23,361,593	Y462H	possibly damaging	Het
Utp14b	C	A	1: 78,665,431	Q349K	probably damaging	Het
Utp20	G	T	10: 88,749,443	D2586E	probably benign	Het
Vmn1r173	A	G	7: 23,703,235	I298M	unknown	Het
Vmn1r37	T	A	6: 66,731,477	I29K	probably benign	Het
Vmn2r23	G	A	6: 123,702,915	G32D	probably damaging	Het
Xpo7	A	T	14: 70,693,991	F296I	probably damaging	Het
Zfhx4	A	G	3: 5,412,714	E3463G	probably damaging	Het
Zfp455	G	T	13: 67,207,445	R194L	probably benign	Het
Zfp663	T	C	2: 165,352,731	T523A	possibly damaging	Het

Other mutations in Intu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01292:Intu	APN	3	40664266	missense	probably benign	0.12
IGL01386:Intu	APN	3	40692587	missense	probably damaging	1.00
IGL02645:Intu	APN	3	40701272	missense	probably benign	0.01
IGL02869:Intu	APN	3	40687786	missense	probably damaging	1.00
IGL03263:Intu	APN	3	40672597	nonsense	probably null
H8562:Intu	UTSW	3	40692673	missense	probably damaging	1.00
PIT4495001:Intu	UTSW	3	40697603	missense	probably benign	0.07
R0010:Intu	UTSW	3	40654272	intron	probably benign
R0173:Intu	UTSW	3	40675346	critical splice donor site	probably null
R0426:Intu	UTSW	3	40675305	missense	probably damaging	0.97
R1566:Intu	UTSW	3	40692578	missense	probably damaging	0.99
R1619:Intu	UTSW	3	40697631	nonsense	probably null
R1658:Intu	UTSW	3	40692781	missense	probably benign	0.20
R1701:Intu	UTSW	3	40664264	missense	probably damaging	1.00
R1707:Intu	UTSW	3	40540924	missense	probably benign	0.03
R1707:Intu	UTSW	3	40683501	missense	possibly damaging	0.69
R1868:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R2090:Intu	UTSW	3	40683536	missense	probably benign	0.00
R2310:Intu	UTSW	3	40653813	missense	probably benign
R2989:Intu	UTSW	3	40692710	missense	probably benign	0.11
R4168:Intu	UTSW	3	40672623	missense	probably benign	0.00
R4530:Intu	UTSW	3	40683364	missense	possibly damaging	0.95
R5093:Intu	UTSW	3	40692917	missense	probably benign	0.00
R5541:Intu	UTSW	3	40692587	splice site	probably null
R5587:Intu	UTSW	3	40675308	missense	probably damaging	0.99
R5745:Intu	UTSW	3	40692972	splice site	probably null
R5809:Intu	UTSW	3	40679590	missense	probably damaging	0.99
R5939:Intu	UTSW	3	40692584	missense	probably damaging	1.00
R5953:Intu	UTSW	3	40679550	missense	probably damaging	1.00
R6000:Intu	UTSW	3	40654148	nonsense	probably null
R6063:Intu	UTSW	3	40654094	missense	probably damaging	0.97
R6245:Intu	UTSW	3	40675326	missense	probably damaging	0.98
R6310:Intu	UTSW	3	40701291	nonsense	probably null
R6353:Intu	UTSW	3	40653708	missense	probably damaging	1.00
R6451:Intu	UTSW	3	40701293	missense	possibly damaging	0.94
R6660:Intu	UTSW	3	40531951	missense	probably benign	0.00
R6848:Intu	UTSW	3	40694255	missense	probably benign	0.00
R7440:Intu	UTSW	3	40697551	missense	probably benign	0.04
R7625:Intu	UTSW	3	40697599	missense	probably benign
R7633:Intu	UTSW	3	40654253	missense	probably damaging	1.00
R7798:Intu	UTSW	3	40691929	missense	probably damaging	1.00
R7877:Intu	UTSW	3	40699792	missense	probably benign	0.07
R7978:Intu	UTSW	3	40697639	missense	probably damaging	1.00
R8319:Intu	UTSW	3	40653772	missense	probably damaging	1.00
R8332:Intu	UTSW	3	40675289	missense	probably benign	0.35
R8860:Intu	UTSW	3	40672732	missense	probably benign	0.07
R8926:Intu	UTSW	3	40653709	missense	possibly damaging	0.69
R8946:Intu	UTSW	3	40683359	missense	possibly damaging	0.93
R9164:Intu	UTSW	3	40690703	missense	probably damaging	1.00
R9191:Intu	UTSW	3	40692511	missense	probably damaging	0.99
R9547:Intu	UTSW	3	40654106	missense	probably benign
Z1177:Intu	UTSW	3	40697516	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GGTCTAACCTTGGATAAGTCCCC -3'
(R):5'- CCCCAAAGGCAAGTGTTAGC -3'

Sequencing Primer
(F):5'- TTGGATAAGTCCCCGAATGC -3'
(R):5'- CCCAAAGGCAAGTGTTAGCAAAAG -3'

Posted On

2014-06-30